ID: 1000172388

View in Genome Browser
Species Human (GRCh38)
Location 5:158714925-158714947
Sequence GGTCCACCTAAGTAAAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000172388_1000172394 14 Left 1000172388 5:158714925-158714947 CCCTCTTTTTACTTAGGTGGACC 0: 1
1: 0
2: 1
3: 2
4: 111
Right 1000172394 5:158714962-158714984 GCATGCTTGGTTCTAATAATAGG No data
1000172388_1000172395 15 Left 1000172388 5:158714925-158714947 CCCTCTTTTTACTTAGGTGGACC 0: 1
1: 0
2: 1
3: 2
4: 111
Right 1000172395 5:158714963-158714985 CATGCTTGGTTCTAATAATAGGG 0: 1
1: 0
2: 0
3: 10
4: 137
1000172388_1000172392 1 Left 1000172388 5:158714925-158714947 CCCTCTTTTTACTTAGGTGGACC 0: 1
1: 0
2: 1
3: 2
4: 111
Right 1000172392 5:158714949-158714971 CCATATTTAGCCTGCATGCTTGG 0: 1
1: 0
2: 0
3: 4
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000172388 Original CRISPR GGTCCACCTAAGTAAAAAGA GGG (reversed) Intronic
907986018 1:59531424-59531446 GGTCCCCCAAAATAAAAAGCTGG + Intronic
908110061 1:60888054-60888076 GGTCTCCCTAAGTACAATGAGGG - Intronic
910488999 1:87747080-87747102 GGTTCTCCTAATAAAAAAGATGG - Intergenic
912483662 1:110006325-110006347 ACTACACCTAAGTAAAAAGTAGG - Intronic
921625712 1:217375622-217375644 GATCCAACAAAGTAAAAAAATGG + Intergenic
921706287 1:218325293-218325315 GTCCCACCAAAGGAAAAAGAAGG - Intronic
923887221 1:238171926-238171948 CTTCCACCTGAGTGAAAAGAAGG + Intergenic
1063124642 10:3127707-3127729 TGTCCTCCTAAGCACAAAGATGG + Intronic
1064281239 10:13953406-13953428 GGTCAACCGAAGTCCAAAGATGG + Intronic
1069468874 10:68668277-68668299 GATCCAAATAAGGAAAAAGATGG - Intronic
1071037150 10:81261643-81261665 TCTCCACCTACTTAAAAAGAAGG - Intergenic
1074347898 10:112706010-112706032 AGTCCACCTAACACAAAAGATGG - Intronic
1085149238 11:74235228-74235250 TGTCCACCTAAGTACAACTAAGG - Intronic
1086622425 11:88903092-88903114 TGTGCACCTGAGTGAAAAGAGGG + Intronic
1087921389 11:103870809-103870831 GGCCCATCTAAGTAAAATAAGGG + Intergenic
1090094933 11:123733458-123733480 GGACTCCCAAAGTAAAAAGATGG - Intronic
1090471812 11:126987674-126987696 GTCCCACTGAAGTAAAAAGAAGG + Intronic
1094459717 12:30682225-30682247 GGTACAAGTAAGTACAAAGAAGG + Intronic
1096802302 12:54118986-54119008 GCCCCACCTCAGTAACAAGAGGG + Intergenic
1098593703 12:72245291-72245313 TATCCACCTATGTAAAGAGATGG - Intronic
1107479736 13:40776115-40776137 AATCCACCTAGGAAAAAAGATGG - Intergenic
1108567719 13:51717544-51717566 AGGCCCCCTCAGTAAAAAGAGGG + Intronic
1115789033 14:36858126-36858148 GGACCTCCTAGGGAAAAAGAGGG - Intronic
1122222847 14:100252151-100252173 AGTCCAGAGAAGTAAAAAGATGG - Intronic
1122833676 14:104420471-104420493 GGTCCACCAAAGGAGAAACATGG + Intergenic
1126266881 15:46765449-46765471 GGTCCAATTAAGTAGAAAGCAGG + Intergenic
1128532669 15:68465220-68465242 GGCCCACCTAAGAAAGAAGTAGG - Intergenic
1128676294 15:69611446-69611468 GGTCGACCTATGAATAAAGAAGG + Intergenic
1130791946 15:87164758-87164780 AGCCCACCAAACTAAAAAGAAGG - Intergenic
1139589304 16:67924606-67924628 GGTCCAGCCAAGACAAAAGAGGG - Intronic
1140354408 16:74293077-74293099 GGTTCACCTAAGAAAAGTGAGGG + Intergenic
1144161733 17:12566758-12566780 GGTCCAGCAAAGTGAAGAGAGGG - Intergenic
1144394290 17:14828519-14828541 AGTCCAAGTAAGTAAAAAGAGGG + Intergenic
1148964897 17:51426902-51426924 GGTCCTTCTAAGGAAAAAAAGGG + Intergenic
1160445721 18:78925604-78925626 GGTGCGCGCAAGTAAAAAGAAGG - Intergenic
925035656 2:683398-683420 GGTACACCTAAGTGAACACAAGG - Intergenic
928099281 2:28426090-28426112 GAGCGACCTGAGTAAAAAGAGGG - Intergenic
929881797 2:45843237-45843259 GCTCCACCAAAGTTAACAGATGG - Intronic
930422783 2:51175241-51175263 GGCTCAACTAAGTAAAATGAAGG + Intergenic
935202516 2:100870351-100870373 GGTCCCTGTAAGAAAAAAGATGG - Intronic
935556176 2:104511939-104511961 GGTTCACCAAACTAAAATGAAGG - Intergenic
936711838 2:115140772-115140794 GATCCACATAATTAAAAGGATGG + Intronic
936795634 2:116200429-116200451 CTTCCACCTTAGAAAAAAGAAGG - Intergenic
937505692 2:122534050-122534072 GTCCTACCTAAGTAGAAAGATGG - Intergenic
943471549 2:188300610-188300632 GGTCAAGCCAAGCAAAAAGAAGG - Intronic
947110497 2:226713792-226713814 GAGCCACCTAAGTAAAAATGGGG + Intergenic
1169853908 20:10082922-10082944 GTTTCACCATAGTAAAAAGATGG + Intergenic
1171431606 20:25086354-25086376 GTTCCACCTGAGAAGAAAGAAGG - Intergenic
1172476430 20:35241697-35241719 GCTCCTCCTCAGTAAAAAGCTGG - Intronic
1174376563 20:50130009-50130031 GGTCCCTCTAAGTAAAAGGTGGG + Intronic
1177002286 21:15629123-15629145 GGCCCACCGAAGTAGAAAGTGGG + Intergenic
1179090508 21:38261039-38261061 GGGCCATCAAAGAAAAAAGAGGG + Intronic
1180081421 21:45489470-45489492 GATCCCCCTAAGTGAAAAAAGGG - Exonic
1180690186 22:17707977-17707999 GGTAGACCTAAGTAAAAATCAGG - Intronic
1184061386 22:42084314-42084336 GCTCCAGCAAATTAAAAAGAAGG + Intergenic
950905002 3:16530206-16530228 AGTCCACCCAAGTAGAGAGAGGG + Intergenic
958696806 3:97538353-97538375 GGTTTCCATAAGTAAAAAGATGG + Intronic
964619937 3:158711254-158711276 GGTCCACCTAAGTATTATGTTGG - Intronic
966563094 3:181345421-181345443 GCTTCACCAAAGTAGAAAGATGG + Intergenic
970436897 4:16044500-16044522 GGGCCACCAAAGGCAAAAGAGGG - Intronic
973703247 4:53556793-53556815 GGTCCAGCTAATTACAAAGGAGG + Intronic
974278264 4:59756047-59756069 AGTCCACTTATGTAAAAAAATGG + Intergenic
975879221 4:78883549-78883571 GGTCCCTATAAGTAAAAATATGG - Intronic
978723699 4:111945622-111945644 GGTCCACTTATGTACAAAGTTGG - Intergenic
978725862 4:111968555-111968577 GGCCCACCTAAGCAGATAGAAGG - Intergenic
979426911 4:120578996-120579018 ATTCCAGCTAAGTAAAAACAGGG - Intergenic
980186496 4:129468242-129468264 GGTACACATAAGTAACTAGAGGG - Intergenic
981253787 4:142636409-142636431 GGAAAACCTAAGTAAATAGAAGG + Intronic
983265865 4:165507471-165507493 GTTGTACCTAAATAAAAAGATGG + Intergenic
987791907 5:22579172-22579194 GATCCATCTAATTTAAAAGACGG + Intronic
991089775 5:62682930-62682952 GGCCCACCTACGTAAACTGAGGG - Intergenic
991169867 5:63610938-63610960 GGTTCACTTAAGTACAGAGAAGG + Intergenic
992156358 5:73958796-73958818 GGGCCACCTAATTAAAAAGATGG + Intergenic
993312629 5:86354943-86354965 AAACCACCTAATTAAAAAGAGGG - Intergenic
993559550 5:89388607-89388629 GGTACATCTTAGTAAAATGATGG + Intergenic
994042635 5:95275446-95275468 GGGCCACCAAAGTAAAGACAAGG - Intronic
994290143 5:98019956-98019978 TGTCAACTTAAGTAAACAGATGG + Intergenic
995832778 5:116372378-116372400 GGTCCACATCTGTAAAATGAGGG - Intronic
998354873 5:141526646-141526668 GGTACACCTATAAAAAAAGAAGG + Intronic
1000172388 5:158714925-158714947 GGTCCACCTAAGTAAAAAGAGGG - Intronic
1004670749 6:17794264-17794286 GGTCCACCAAACTCCAAAGAGGG - Exonic
1005610745 6:27522328-27522350 AGTCCATCTAAGTTAAAAGTGGG - Intergenic
1007319325 6:41015686-41015708 GTTCCCCCTAAATAAAAATATGG + Intergenic
1016599577 6:145842628-145842650 GGCCCAATTAAGTCAAAAGATGG + Intergenic
1016653649 6:146492765-146492787 TCTCCACCTAAGAAATAAGAGGG - Intergenic
1016989025 6:149916726-149916748 GGTACACCTAATTGAAAAGGAGG - Intergenic
1016993969 6:149947938-149947960 GGTACACCTAATTGAAAAGGAGG + Intronic
1017004364 6:150019599-150019621 GGTACACCTAATTGAAAAGGAGG - Intronic
1020836900 7:13164793-13164815 GGTTCACCTCAGTAAAGAAAAGG - Intergenic
1022440991 7:30433173-30433195 GGTCAGCCTAAGGAAAAAAAAGG + Exonic
1024849964 7:53701142-53701164 TGTCCACGTAAGGAAAATGAAGG + Intergenic
1026206005 7:68258070-68258092 GGTACACATAAATATAAAGATGG + Intergenic
1031791736 7:126115124-126115146 CTTCCACCTAAAAAAAAAGATGG + Intergenic
1032691591 7:134293241-134293263 GTTCCAGCTAAGTAAAGAAAAGG + Exonic
1036696286 8:10977204-10977226 GTTCCATCTTAGTAAAATGAGGG - Intronic
1037513148 8:19603773-19603795 TGGCCATCTAAGTAAAAAGGGGG + Intronic
1038278591 8:26142470-26142492 GCTCCACTGAAGTAAACAGATGG + Intergenic
1039271818 8:35890361-35890383 TTTCCACCCAAGAAAAAAGACGG - Intergenic
1041594850 8:59637148-59637170 TGTCCATCATAGTAAAAAGAGGG - Intergenic
1042899642 8:73711035-73711057 GTAAGACCTAAGTAAAAAGAAGG + Intronic
1044990522 8:97791425-97791447 GGTGCACGTAATTAACAAGAAGG - Intronic
1047131889 8:122030390-122030412 GTTTCACCTAAGTCCAAAGAAGG + Intergenic
1047750742 8:127878648-127878670 GGTCTAGTTAATTAAAAAGAAGG + Intergenic
1048406601 8:134128913-134128935 GGTCCAACTTAGAAAAAAGGGGG - Intergenic
1051389206 9:16545577-16545599 GGTCCAACTCTATAAAAAGAAGG + Intronic
1056019827 9:82430281-82430303 GTTCCACCTAATGAAAAAGGAGG - Intergenic
1056128841 9:83564313-83564335 AGTCCACCTAACTAGGAAGAAGG + Intergenic
1056200442 9:84270464-84270486 TGTCCACTTAAATAAAAAGATGG - Intergenic
1186230736 X:7450908-7450930 GTTCCTCCTAAGTTGAAAGATGG - Intergenic
1186568185 X:10686682-10686704 GATCCACATCAGTAAAGAGAAGG + Intronic
1187756670 X:22535087-22535109 GGTCCAAATAAGTTAAAACATGG - Intergenic
1196561745 X:117157751-117157773 TGTCCACATATGTAAAATGAGGG - Intergenic
1198231037 X:134689702-134689724 TGCCCTCCTAAGTAAAATGAGGG + Intronic
1200944181 Y:8816023-8816045 GGTGCACCAAAGTATAAAGTTGG + Intergenic
1201292211 Y:12431894-12431916 GCTCAACCTAACTAAAAACACGG - Intergenic