ID: 1000172389

View in Genome Browser
Species Human (GRCh38)
Location 5:158714926-158714948
Sequence AGGTCCACCTAAGTAAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000172389_1000172392 0 Left 1000172389 5:158714926-158714948 CCTCTTTTTACTTAGGTGGACCT 0: 1
1: 0
2: 1
3: 11
4: 167
Right 1000172392 5:158714949-158714971 CCATATTTAGCCTGCATGCTTGG 0: 1
1: 0
2: 0
3: 4
4: 79
1000172389_1000172395 14 Left 1000172389 5:158714926-158714948 CCTCTTTTTACTTAGGTGGACCT 0: 1
1: 0
2: 1
3: 11
4: 167
Right 1000172395 5:158714963-158714985 CATGCTTGGTTCTAATAATAGGG 0: 1
1: 0
2: 0
3: 10
4: 137
1000172389_1000172394 13 Left 1000172389 5:158714926-158714948 CCTCTTTTTACTTAGGTGGACCT 0: 1
1: 0
2: 1
3: 11
4: 167
Right 1000172394 5:158714962-158714984 GCATGCTTGGTTCTAATAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000172389 Original CRISPR AGGTCCACCTAAGTAAAAAG AGG (reversed) Intronic
904569868 1:31455262-31455284 AGGACCACCCAAGTGGAAAGGGG + Intergenic
905486241 1:38298831-38298853 AGGGACACCTAGGTTAAAAGAGG - Intergenic
907002952 1:50880725-50880747 ACGGCCACCTGAGTAAAATGTGG + Intronic
908110062 1:60888055-60888077 AGGTCTCCCTAAGTACAATGAGG - Intronic
910808045 1:91208132-91208154 AGGACCACCTTAGTGGAAAGGGG + Intergenic
910852928 1:91666253-91666275 AGGACCACCTTAGTGGAAAGGGG + Intergenic
911008625 1:93254626-93254648 ATTTCCACCTAAGGAACAAGTGG + Intronic
912816056 1:112829597-112829619 AGGACCACCTTAGTGGAAAGCGG - Intergenic
915605969 1:156951061-156951083 ATGTCCACCTCAGCAAAGAGAGG - Intronic
916074448 1:161192270-161192292 GGTTCCTCCTAAGTCAAAAGGGG + Intronic
918254034 1:182731829-182731851 AAGGTCACCTAAGTAATAAGTGG - Intergenic
920781855 1:209001049-209001071 AAATCCACCCAATTAAAAAGTGG + Intergenic
921074673 1:211690776-211690798 AGGACCACCTTAGTGGAAAGGGG - Intergenic
921927180 1:220721129-220721151 AGGACCACCTTAGTGGAAAGGGG - Intergenic
922056596 1:222048177-222048199 AGGTCCTCCTTTGTAAGAAGTGG + Intergenic
924859040 1:247902128-247902150 AGGACCACCTTAGTGGAAAGGGG + Intergenic
1064688473 10:17889136-17889158 AGATACACATAAGTTAAAAGTGG - Intronic
1064871947 10:19947020-19947042 GGGTCCTTATAAGTAAAAAGCGG + Intronic
1068100733 10:52549826-52549848 AGATCCTCCTGAGTAAAAAGTGG - Intergenic
1068671766 10:59730274-59730296 AGGACCACCTTAGTGGAAAGGGG + Intronic
1068675768 10:59767751-59767773 AGGACCACCTTAGTGGAAAGGGG + Intergenic
1068703119 10:60041456-60041478 ACGCTCACATAAGTAAAAAGTGG - Intronic
1069939279 10:71943397-71943419 AGGACCACCTTAGTGGAAAGGGG - Intergenic
1072640389 10:97207082-97207104 AGGTTCACTTAATTAAAATGAGG + Intronic
1077703550 11:4463066-4463088 AGGACCATCCAAGTAGAAAGGGG - Intergenic
1079954197 11:26842472-26842494 AGGTCTACATAAGTGGAAAGAGG - Intergenic
1083082174 11:60105177-60105199 AGGACCACCTTAGTAGAAAAGGG + Intergenic
1083089921 11:60189375-60189397 AGGACCACCTTAGTGGAAAGGGG - Intergenic
1085239813 11:75043998-75044020 AGGACCACCTTAGTGGAAAGGGG - Intergenic
1085998777 11:81954152-81954174 AGGACCACCTTAGTGGAAAGGGG - Intergenic
1086078111 11:82876227-82876249 AGGTACACCTAGCTAGAAAGTGG - Intronic
1086771057 11:90768105-90768127 AGGTCTAGCAAAGTAAAATGAGG - Intergenic
1086973431 11:93107315-93107337 AGGACCACCTTAGTGGAAAGGGG + Intergenic
1087659032 11:100964142-100964164 AAGTCCAGCTCAGTATAAAGGGG + Intronic
1087894845 11:103575981-103576003 AGGACCACCTTAGTGGAAAGGGG - Intergenic
1088427163 11:109716421-109716443 AGGGCCTGCTAAGGAAAAAGTGG + Intergenic
1088842908 11:113641722-113641744 AGGTTCTCCTAAGAGAAAAGGGG - Intergenic
1092734353 12:11566310-11566332 AAGACCACCCAAGTAAAAATGGG - Intergenic
1093267382 12:17019560-17019582 ATGTCCACCTCTGTAAGAAGTGG - Intergenic
1096802301 12:54118985-54119007 AGCCCCACCTCAGTAACAAGAGG + Intergenic
1098248423 12:68544155-68544177 AGGACCACCTTAGTGGAAAGGGG - Intergenic
1101912767 12:108872883-108872905 AGGGCCATGTAAGTACAAAGTGG + Intronic
1103851638 12:123937271-123937293 AGGTCCACCTCATCAAAGAGAGG - Exonic
1105569502 13:21588338-21588360 AGGACCACCTTAGTGGAAAGGGG - Intronic
1106956610 13:34944493-34944515 AGGTACAAAAAAGTAAAAAGAGG - Intronic
1108567718 13:51717543-51717565 AAGGCCCCCTCAGTAAAAAGAGG + Intronic
1109692953 13:65917260-65917282 AGGTCCACATAAAAAAAATGTGG + Intergenic
1110653679 13:77972227-77972249 AGGACCACCTTAATAGAAAGGGG + Intergenic
1112124209 13:96446943-96446965 AGGCACACCTAGGGAAAAAGAGG - Intronic
1113424041 13:110193200-110193222 AGGGCTGCCTCAGTAAAAAGTGG + Intronic
1114649339 14:24274052-24274074 AGGGCCACCCATGTAATAAGTGG + Intergenic
1114924184 14:27372956-27372978 AGGTCAATCTAATTAAAAAAGGG - Intergenic
1114951903 14:27765198-27765220 AAAACAACCTAAGTAAAAAGTGG + Intergenic
1115211449 14:30970877-30970899 AGGACCACCTTAGTGGAAAGGGG - Intronic
1117955166 14:61117165-61117187 AGGACCACCTTAGTGGAAAGGGG + Intergenic
1118221086 14:63854586-63854608 ATGTCAAAATAAGTAAAAAGTGG + Intronic
1118636455 14:67752689-67752711 AGGTCTACCTAACTCCAAAGAGG - Intronic
1118806988 14:69246450-69246472 AGGGCCACATAAGGAAACAGTGG - Intergenic
1119178808 14:72589954-72589976 AGGATAACCTAATTAAAAAGTGG + Intergenic
1139285217 16:65806831-65806853 ATGTCCAAGTTAGTAAAAAGTGG + Intergenic
1144168813 17:12638521-12638543 AGTTCCTCATCAGTAAAAAGAGG - Intergenic
1144394289 17:14828518-14828540 GAGTCCAAGTAAGTAAAAAGAGG + Intergenic
1147810278 17:43164001-43164023 AGGACCACCTTAGTGGAAAGGGG + Intergenic
1148467886 17:47875656-47875678 ATGTCCATCTCAGGAAAAAGAGG - Intergenic
1152454975 17:80409694-80409716 AGGACCACCTTAGTGGAAAGGGG - Intergenic
1153830416 18:8917593-8917615 AGGACCACCTTAGTGGAAAGGGG - Intergenic
1157211381 18:45745417-45745439 TGGTGCATCTAAGGAAAAAGGGG + Intronic
1162283621 19:9720616-9720638 AGGACCACCCAAGTGGAAAGGGG - Intergenic
1163991884 19:21006569-21006591 AGGACCACCTTAGTGGAAAGGGG - Intergenic
1164121536 19:22269658-22269680 AGGACCACCTTAGTGGAAAGGGG + Intergenic
925741846 2:7012265-7012287 AGCACCAGCTAAGTAAATAGTGG - Intronic
928099282 2:28426091-28426113 AGAGCGACCTGAGTAAAAAGAGG - Intergenic
928673422 2:33626118-33626140 AGGTCCACCTGGGTCAAATGAGG + Intergenic
928826311 2:35425598-35425620 AGGTGCATCTAAGTAAAGAAGGG + Intergenic
929910467 2:46085287-46085309 ATATCCTCCAAAGTAAAAAGTGG + Intronic
930360521 2:50372460-50372482 AGGTTCACCTAAATAAACACTGG + Intronic
935249876 2:101252098-101252120 AGGGCAATCTAAGTAAAACGTGG + Intronic
935721460 2:105982908-105982930 AGGACCACCTTAGTGGAAAGGGG + Intergenic
935958794 2:108403628-108403650 AGGACCACCCAAGTGGAAAGGGG - Intergenic
938714086 2:134002966-134002988 AGGCCCTCCTAGGTGAAAAGAGG + Intergenic
939790378 2:146566302-146566324 GGGTTTACCTAAGTAAGAAGAGG + Intergenic
942888957 2:180964006-180964028 AGGTACACATAAGTAGAAATTGG + Intergenic
943408127 2:187514316-187514338 AGGACCACCTTAGTGGAAAGGGG - Intronic
945289769 2:208115732-208115754 AGGACCACCTTAGTGGAAAGGGG - Intergenic
945483346 2:210367066-210367088 AGGACCACCCAAGTGGAAAGGGG + Intergenic
945720316 2:213410766-213410788 AGGACCACCTTAGTGGAAAGGGG - Intronic
947110496 2:226713791-226713813 AGAGCCACCTAAGTAAAAATGGG + Intergenic
1172025414 20:31945175-31945197 AGGCCCTCCTGAGTAAAGAGTGG + Exonic
1173277644 20:41598503-41598525 AGGACCATCCAAGTAGAAAGGGG - Intronic
1174376562 20:50130008-50130030 AGGTCCCTCTAAGTAAAAGGTGG + Intronic
1177002285 21:15629122-15629144 TGGCCCACCGAAGTAGAAAGTGG + Intergenic
1178102878 21:29289115-29289137 AATTTTACCTAAGTAAAAAGAGG - Intronic
1178960868 21:37063710-37063732 AGTTACACCTCAATAAAAAGGGG - Exonic
1179670852 21:42946557-42946579 AGGACCACCTTAGTGGAAAGGGG + Intergenic
1181882075 22:25989133-25989155 AGGTTCACCTAAGCAAAACGAGG + Intronic
1182010602 22:26997811-26997833 AGGTACAATTAACTAAAAAGTGG + Intergenic
950905001 3:16530205-16530227 AAGTCCACCCAAGTAGAGAGAGG + Intergenic
951248520 3:20367781-20367803 AGGACCACCTTAGTAGAAAGGGG + Intergenic
953565134 3:44026061-44026083 ATATGCACCTAAGTAAAATGTGG + Intergenic
959313306 3:104769510-104769532 AGGCACAACTAAGTATAAAGAGG + Intergenic
962097402 3:132306591-132306613 AGGACCACCTTAGTGGAAAGGGG - Intergenic
962277097 3:134023817-134023839 AGGACCACCTTAGTGGAAAGGGG - Intronic
963420685 3:145057228-145057250 AGGTATACCTTAGTAAATAGAGG - Intergenic
963678460 3:148344901-148344923 AGGTCTATTTAAGTAAAGAGTGG + Intergenic
964796640 3:160505363-160505385 AATTCCATTTAAGTAAAAAGCGG + Intronic
972991194 4:44823914-44823936 AGGACCACCTTAGTGAAAAGGGG + Intergenic
976818394 4:89176476-89176498 AGGTCCTCATCAGTAAAAGGAGG + Intergenic
977043541 4:92042207-92042229 AGGACCACCTTAGTGGAAAGGGG + Intergenic
979708375 4:123748405-123748427 AGGTCCCTCTCTGTAAAAAGAGG + Intergenic
980073031 4:128263851-128263873 AGGACCACCTTAGTGGAAAGGGG - Intergenic
981669666 4:147273895-147273917 AGGTCTACCTCAGTGAACAGAGG - Intergenic
983708470 4:170687022-170687044 AGGACCACCTTAGTGGAAAGGGG - Intergenic
983898002 4:173102438-173102460 AGGACCACCTTAGTGGAAAGGGG - Intergenic
984012903 4:174391947-174391969 AGGTCCATATAAGTTAAATGAGG - Intergenic
984086479 4:175318880-175318902 AGGTCCACCAAAAAAAAAACTGG + Intergenic
989096016 5:37781884-37781906 AGGACCACCTTAGTGGAAAGGGG + Intergenic
989613449 5:43316857-43316879 AGGACCACCTTAGTGGAAAGGGG + Intergenic
991089776 5:62682931-62682953 AGGCCCACCTACGTAAACTGAGG - Intergenic
991306109 5:65177825-65177847 AGGACCACCTTAGTGGAAAGGGG - Intronic
991593877 5:68282629-68282651 AATTCCACCAAAGTAAAAACGGG + Intronic
993643676 5:90436495-90436517 AGGTCTTCCCAATTAAAAAGAGG + Intergenic
1000172389 5:158714926-158714948 AGGTCCACCTAAGTAAAAAGAGG - Intronic
1002999087 6:2314197-2314219 AGGACCACCTTAGTGGAAAGGGG + Intergenic
1003492234 6:6633191-6633213 AGCTCTACCCAATTAAAAAGTGG + Intronic
1003610662 6:7612185-7612207 AAGTCCACCTAAGAAAAAAGAGG + Intergenic
1003843842 6:10151643-10151665 AGGTCAACTTAAGAAAAATGTGG + Intronic
1004670750 6:17794265-17794287 AGGTCCACCAAACTCCAAAGAGG - Exonic
1005461968 6:26077937-26077959 AGGACCACCTTAGTGGAAAGGGG - Intergenic
1005610746 6:27522329-27522351 AAGTCCATCTAAGTTAAAAGTGG - Intergenic
1006325743 6:33352492-33352514 AGGACCACCTTAGTGGAAAGGGG + Intergenic
1008123501 6:47644366-47644388 AGGACCACCTTAGTGGAAAGGGG - Intergenic
1008845703 6:55960891-55960913 ATGTCAAACTAAGTAAACAGAGG + Intergenic
1009353921 6:62716457-62716479 AGGTTCACCTAATTATTAAGGGG + Intergenic
1010259513 6:73799006-73799028 AATTCAACCTAAGAAAAAAGAGG - Intronic
1013879055 6:114871710-114871732 AGGCATACCTAAGTAAATAGGGG - Intergenic
1015614424 6:135060215-135060237 AAATCCAGCTAAGTAAAAATTGG + Intronic
1017086876 6:150721275-150721297 AGGTCCACCGAGGTGAGAAGGGG + Intronic
1018465321 6:164038630-164038652 AGGTCCAGCTATGTAAATTGTGG + Intergenic
1021191085 7:17620328-17620350 ATGTCCACCTGAATAAACAGAGG - Intergenic
1023799141 7:43818350-43818372 AGGACCACCTTAGTGGAAAGGGG - Intergenic
1026623488 7:71972066-71972088 AGCTCAACCCAACTAAAAAGAGG + Intronic
1027293889 7:76746214-76746236 AGGTTCACCTAGGTAGTAAGCGG - Intergenic
1028334057 7:89629331-89629353 AGGACCACCTTAGTGGAAAGGGG - Intergenic
1029822101 7:103156448-103156470 AGGACCACCTTAGTGGAAAGGGG - Intergenic
1037513147 8:19603772-19603794 TTGGCCATCTAAGTAAAAAGGGG + Intronic
1037678176 8:21070431-21070453 AGGTCCACTTAAGAAGAGAGAGG + Intergenic
1038089694 8:24239508-24239530 AGGACCACCTTAGTGGAAAGGGG - Intergenic
1040286260 8:46101968-46101990 AGGTCCCCACAAGTAAAAATGGG - Intergenic
1040312096 8:46242087-46242109 AGGTCCCCATAAGCAAAAATGGG + Intergenic
1040335836 8:46415523-46415545 AGGTCCCCCAAAGCAAAAACCGG + Intergenic
1040747845 8:50667694-50667716 AGTACCATCTTAGTAAAAAGAGG + Intronic
1041515498 8:58695042-58695064 AGGACCACCTTAGTGGAAAGGGG - Intergenic
1041836170 8:62218589-62218611 AGGTCCTTCTTTGTAAAAAGAGG - Intergenic
1042671522 8:71268687-71268709 AGGTACACCTAATCAAAAATAGG - Intronic
1043076299 8:75705514-75705536 AGGTCCAACTAAGTAATCAGAGG + Intergenic
1044118399 8:88363474-88363496 AGGTCAACCTAAGTGAATACTGG - Intergenic
1044513549 8:93112082-93112104 AGGTCCTTCTAAGTGAAAAAGGG + Intergenic
1045031239 8:98138436-98138458 AGGTTCAGCAAAGTAAAGAGTGG - Intronic
1046324996 8:112630308-112630330 AAGTCCAGCTAGGAAAAAAGAGG + Intronic
1048406602 8:134128914-134128936 GGGTCCAACTTAGAAAAAAGGGG - Intergenic
1058536971 9:105971561-105971583 AGGTCCACTAAAATAAAAATGGG - Intergenic
1189034636 X:37483130-37483152 AGGACCACCTTAGTGGAAAGGGG - Intronic
1189833803 X:45000873-45000895 AGGACCACCTTAGTGGAAAGGGG + Intronic
1190270297 X:48857989-48858011 AGGACCACCTTAGTGGAAAGGGG - Intergenic
1190771249 X:53516639-53516661 AGGACCACCTTAGTGGAAAGGGG - Intergenic
1191639265 X:63412899-63412921 AGGACCACCTTAGTGGAAAGGGG - Intergenic
1191917946 X:66222356-66222378 AGGACCACCTTAGTGGAAAGGGG + Intronic
1191976307 X:66875487-66875509 ATGTCCACGTAAGTACAAAATGG - Intergenic
1192803263 X:74487235-74487257 AGGGGCACCCATGTAAAAAGGGG + Intronic
1192915440 X:75646480-75646502 AGGACCACCTTAGTGGAAAGGGG + Intergenic
1194345598 X:92760605-92760627 AAGTTCACCTAAATAAAAAGTGG - Intergenic
1194431244 X:93809406-93809428 AGGCCCACCTAATTAAAGGGAGG - Intergenic
1195370890 X:104171101-104171123 AGGCCCACCTGAGAGAAAAGGGG + Intronic
1195846776 X:109237585-109237607 AGGACCACCTTAGTGGAAAGGGG + Intergenic
1196089971 X:111729848-111729870 ATGTCCACCTAAGGAAACAGTGG + Intronic
1196422967 X:115541475-115541497 AGGACCACCTTAGTGGAAAGAGG + Intergenic
1196561746 X:117157752-117157774 ATGTCCACATATGTAAAATGAGG - Intergenic
1200653942 Y:5877256-5877278 AAGTTCACCTAAATAAAAAGTGG - Intergenic
1201260050 Y:12149998-12150020 AGGCCCACCTTAGTGGAAAGGGG + Intergenic
1201308935 Y:12577104-12577126 AGGACCACCTTAGTGGAAAGAGG - Intergenic