ID: 1000172390

View in Genome Browser
Species Human (GRCh38)
Location 5:158714946-158714968
Sequence AGCATGCAGGCTAAATATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000172390_1000172394 -7 Left 1000172390 5:158714946-158714968 CCTCCATATTTAGCCTGCATGCT 0: 1
1: 0
2: 1
3: 6
4: 141
Right 1000172394 5:158714962-158714984 GCATGCTTGGTTCTAATAATAGG No data
1000172390_1000172395 -6 Left 1000172390 5:158714946-158714968 CCTCCATATTTAGCCTGCATGCT 0: 1
1: 0
2: 1
3: 6
4: 141
Right 1000172395 5:158714963-158714985 CATGCTTGGTTCTAATAATAGGG 0: 1
1: 0
2: 0
3: 10
4: 137
1000172390_1000172396 17 Left 1000172390 5:158714946-158714968 CCTCCATATTTAGCCTGCATGCT 0: 1
1: 0
2: 1
3: 6
4: 141
Right 1000172396 5:158714986-158715008 AGTACTCTACAAAGTGAGTGTGG 0: 1
1: 0
2: 0
3: 7
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000172390 Original CRISPR AGCATGCAGGCTAAATATGG AGG (reversed) Intronic
905971337 1:42144725-42144747 AGGATGCAGTCTAACTGTGGAGG + Intergenic
909689281 1:78388775-78388797 TCCATACTGGCTAAATATGGTGG + Intronic
911885544 1:103293570-103293592 ATCATGAAGGCAAAATCTGGAGG - Intergenic
912403279 1:109414434-109414456 AGCATACAGTCTAATTGTGGTGG - Intronic
913252538 1:116923916-116923938 AGCAACCAGTCTAAATGTGGAGG + Intronic
916879086 1:169001397-169001419 AGCAGGCTGGCTAAAGATGAAGG + Intergenic
922286490 1:224175080-224175102 AGTATGCAGGCTGGACATGGTGG - Intergenic
924322619 1:242865037-242865059 AGCATGCATGCTAGCTGTGGTGG + Intergenic
1063886864 10:10588546-10588568 AGCAGCCATGCTCAATATGGTGG + Intergenic
1064973031 10:21085332-21085354 AGCACGTAGGCCAAGTATGGTGG + Intronic
1068526610 10:58137862-58137884 AACATGCAGGATAAGGATGGGGG - Intergenic
1070212922 10:74345593-74345615 ATCATGCAGGCTGGATGTGGTGG - Intronic
1072337087 10:94406960-94406982 AGCATGGAGGATAAATAGGTGGG - Intronic
1076100567 10:127774394-127774416 AGGATGCAGGCAAAATAAGCAGG - Intergenic
1077972232 11:7206541-7206563 ATCATGCAGGATATATTTGGAGG - Intergenic
1078368362 11:10724925-10724947 TGCATGCAGGCCAACTAGGGTGG + Intergenic
1080232735 11:30035750-30035772 AGGATGCAGCACAAATATGGTGG + Intergenic
1081220932 11:40460495-40460517 AGCATTCTGGATAATTATGGAGG + Intronic
1081897802 11:46602037-46602059 TGCAGACAGGCTAAAGATGGAGG + Intergenic
1082889773 11:58126512-58126534 AGCATTCAGGCGAACTAGGGTGG + Intronic
1087284527 11:96250748-96250770 TGCATACAGACTAAATAGGGAGG + Intronic
1087611596 11:100440938-100440960 AGAATGAAGGCTAAAAGTGGAGG + Intergenic
1088548691 11:110988002-110988024 ACCATACAGGCTAAATTTGGAGG - Intergenic
1089595324 11:119575207-119575229 AGAATGCAAGCTAACCATGGAGG - Intergenic
1090477839 11:127039626-127039648 AGCATGCAAGGAAAATATAGAGG - Intergenic
1097189305 12:57211920-57211942 AGGATGGAGGCTATATCTGGAGG - Exonic
1097589192 12:61552824-61552846 AGTTTGCAGGGTAAATAAGGTGG - Intergenic
1098368600 12:69733723-69733745 ATCATACAGACTAAATATGGTGG + Intergenic
1101545540 12:105708729-105708751 AGGATCCAGGCTGAATGTGGTGG - Intergenic
1102934240 12:116883233-116883255 AGCGTGCAGATTAAAAATGGGGG - Intergenic
1105422746 13:20267301-20267323 TGCATGCAGCCTAACTATGAAGG - Intergenic
1110963329 13:81658600-81658622 ATAATGCAGGCTAACTAGGGTGG - Intergenic
1117236615 14:53783919-53783941 AGCATTCATGCTATATAAGGAGG + Intergenic
1120685994 14:87538441-87538463 AGTATACAGGATAAACATGGAGG - Intergenic
1121148931 14:91612436-91612458 ACCAATCAGGCTAAGTATGGTGG - Intronic
1123430011 15:20206689-20206711 AGGAAGCAGGCTGAACATGGTGG + Intergenic
1128777945 15:70338018-70338040 AGCAAACAGGCCAAATTTGGAGG - Intergenic
1128924971 15:71647025-71647047 AGCATAAAGGCTAAATGTTGTGG - Intronic
1128928315 15:71679471-71679493 AGCATGAGGGCTAAACTTGGCGG - Intronic
1134239913 16:12498009-12498031 AGCAAGCAGGCAAAATATCAAGG + Intronic
1134430973 16:14206093-14206115 AGCATGGAGGCTGAAAAGGGAGG + Intronic
1135146021 16:19963489-19963511 AGCAGCCAAGCTAAACATGGTGG + Intergenic
1136143262 16:28300860-28300882 AGCTTCCAGGCTAGAAATGGCGG + Intronic
1137570657 16:49564352-49564374 GGCATGCTGGCTAAGGATGGGGG + Intronic
1140826443 16:78711113-78711135 AGCCTGCTGGCTAAATTAGGTGG + Intronic
1203116200 16_KI270728v1_random:1492999-1493021 AGGAAGCAGGCTGAACATGGTGG - Intergenic
1145846914 17:28047298-28047320 AGCATGCAGACTATTTTTGGAGG + Intronic
1148246380 17:46033492-46033514 GGCAAGCAGGCTAAAACTGGGGG + Intronic
1148372506 17:47111248-47111270 AGCATACAGGCCAGACATGGTGG - Intergenic
1148667653 17:49386805-49386827 AGCATGGAGGGTAAATAAGAGGG - Intronic
1150686096 17:67322141-67322163 AACAAGCAGGCTCAAAATGGTGG + Intergenic
1153937118 18:9937868-9937890 AACATGCAGATTAAATATGTGGG + Intronic
1157534302 18:48447236-48447258 AGGATGCAGGAAAAGTATGGGGG + Intergenic
1162558622 19:11402779-11402801 AGCATGAAGGGTATATATGATGG - Intronic
1162716363 19:12636845-12636867 ATCATTCAGGCTAAACAGGGAGG - Intronic
1167464603 19:49643852-49643874 AGCTGGGAGGCTGAATATGGAGG + Intronic
1168235571 19:55061075-55061097 AGGATGCAGGTTGAAGATGGAGG - Intronic
927365793 2:22295022-22295044 AGCATGCAGGCTGGGCATGGTGG + Intergenic
927527852 2:23763877-23763899 AACATGCTGGCTGAACATGGTGG - Intronic
928272343 2:29867796-29867818 AGCATGAAGGTCAAATATAGGGG - Intronic
932131025 2:69187276-69187298 AAAATGCAGGCTAAATATCAGGG - Intronic
937401781 2:121590177-121590199 AACATCCAGGATTAATATGGAGG + Intronic
937575786 2:123419790-123419812 TGCTTGCAGGCTAAACCTGGAGG - Intergenic
937658575 2:124404724-124404746 AATATTCAGGCCAAATATGGTGG + Intronic
937738378 2:125318992-125319014 AGAATGCAGGCTTACTCTGGTGG - Intergenic
939608935 2:144286727-144286749 AGAATGCAGAGTAAATGTGGGGG + Intronic
943637160 2:190319106-190319128 CGCATGCAGCCTAAAGATGATGG + Intronic
946670170 2:222094555-222094577 GGCAAGCAGGATCAATATGGAGG + Intergenic
946917349 2:224538466-224538488 AGCAAGCATGGGAAATATGGTGG + Intronic
948192557 2:236071211-236071233 AGCACTCAGGCTAAATATGCAGG + Intronic
1169841446 20:9942574-9942596 ATCCTGCTGGCTAAATAGGGAGG - Intergenic
1170137660 20:13092806-13092828 AAAATGCAGGCAAATTATGGTGG - Intronic
1175907513 20:62388141-62388163 AGCCTGCAGCCTGACTATGGTGG - Intronic
949590583 3:5490362-5490384 AGCATACAGGTTAAAAATGCAGG - Intergenic
949824000 3:8145519-8145541 AGCCTGCAAGCAAAATATGTTGG + Intergenic
953397823 3:42587082-42587104 AGCATGCAGGCCAGAGATAGTGG - Intronic
954146767 3:48638301-48638323 AGCAGCCAGGCCAAATGTGGTGG - Intronic
955275920 3:57546629-57546651 GACATTCAGGCTAGATATGGTGG - Intergenic
955321742 3:57979430-57979452 AGGATGCAGGCTGGGTATGGTGG + Intergenic
956681665 3:71786473-71786495 AGCATTCAGACGAAATGTGGGGG + Intergenic
957209905 3:77246363-77246385 TGCATGTTGGCTAAGTATGGAGG + Intronic
957615409 3:82519883-82519905 AAGATGCAGGCTAAGTATAGTGG - Intergenic
960492645 3:118335146-118335168 AGCCTGCAGGCTTAATCTGCAGG - Intergenic
967020191 3:185515816-185515838 AGCCTGGAGGCTAAGCATGGTGG - Intronic
969876230 4:10137432-10137454 AGCATGCAGGCCTAAGATGTGGG + Intergenic
970846992 4:20552180-20552202 AGAATGCAGGCTGAATGAGGAGG + Intronic
973548336 4:52005127-52005149 ACTATGCAGGCCAAACATGGTGG - Intronic
978465911 4:109008826-109008848 AGCATGCAAGCTGAGTACGGTGG + Intronic
978521606 4:109621426-109621448 AATATGCAGGGTAAAGATGGAGG - Intronic
986436522 5:7737707-7737729 ATCAAGCAGGATAAATATGAAGG + Intronic
993752136 5:91683247-91683269 ATCATGCAGGCTAGAATTGGAGG - Intergenic
994930143 5:106172242-106172264 AGCATGCAGACGAAAAATGCAGG - Intergenic
995947728 5:117670043-117670065 AGCATGCAGGATAAATTTTCTGG - Intergenic
996963813 5:129283912-129283934 AGCATAAAGAATAAATATGGAGG + Intergenic
997713085 5:136022485-136022507 AACCAGCAGGCAAAATATGGTGG + Intergenic
1000172390 5:158714946-158714968 AGCATGCAGGCTAAATATGGAGG - Intronic
1004448368 6:15723568-15723590 TGCATCCATGCTAAATTTGGGGG - Intergenic
1008927471 6:56902195-56902217 AGGGTACAAGCTAAATATGGTGG + Intronic
1009950610 6:70391509-70391531 AGCCTTCAGGCAAAAAATGGAGG - Intergenic
1011773736 6:90705147-90705169 AGCATGCTAGCTAAAAATGAAGG + Intergenic
1014219997 6:118790394-118790416 AGAATACAGGCCAAGTATGGTGG + Intergenic
1014334452 6:120115373-120115395 AGGATGCAGGCCAAGTATGGTGG - Intergenic
1016925009 6:149335990-149336012 AGTATGCAGGGTAAAAGTGGGGG - Intronic
1018286833 6:162249554-162249576 ACAGTGCAGGCAAAATATGGTGG + Intronic
1019723816 7:2589554-2589576 AGCATGAAGGCTGAAAATGTCGG + Intronic
1021586628 7:22215550-22215572 AGGAGCCAGGCTAACTATGGTGG - Intronic
1021730231 7:23588469-23588491 AGAATGTAGGCTGAACATGGTGG + Intergenic
1023381277 7:39610858-39610880 AGGATGCAGGCTGGGTATGGTGG + Intergenic
1026288169 7:68982122-68982144 AGCATGTAGGGTAAATATTTAGG - Intergenic
1026900697 7:74035580-74035602 AGCATACAGGCTGGACATGGTGG + Intronic
1027902106 7:84129883-84129905 AGGATGAAGACTAAATATGAGGG - Intronic
1027938791 7:84645106-84645128 AACATGCAATCAAAATATGGTGG - Intergenic
1029853070 7:103484792-103484814 AGAATGCAGCATAAATATTGTGG - Intronic
1030468591 7:109935018-109935040 AGGATGGAGACTAAATCTGGAGG - Intergenic
1032869478 7:135967846-135967868 AGCATAGAGGCTAAATGTGTTGG - Intronic
1033287968 7:140058806-140058828 AGCATGTAGGCTGGGTATGGTGG + Intronic
1034293452 7:149950191-149950213 ATAATGCAGGCCAAATATAGAGG + Intergenic
1034396159 7:150826378-150826400 GGCAGACAGGCTAAATTTGGAGG + Intronic
1034812614 7:154146662-154146684 ATAATGCAGGCCAAATATAGAGG - Intronic
1034913788 7:155020161-155020183 AGCATGCAGGCTGGGTGTGGTGG + Intergenic
1037926955 8:22851163-22851185 ACCATGCAAGCCAAATGTGGAGG - Intronic
1038045173 8:23760239-23760261 AGAAGGCTGGCTAAACATGGTGG + Intergenic
1039090282 8:33820727-33820749 AGCATGCAAGCTACACAAGGGGG - Intergenic
1040614511 8:49020774-49020796 AGCATACAGGAGAAAGATGGAGG + Intergenic
1040752634 8:50729000-50729022 AGCATGCAAGCTAAATATTGAGG - Intronic
1042374305 8:68031692-68031714 AGCATTCATGCTGAATATGAGGG - Intronic
1043149299 8:76693742-76693764 AGCTTGCAGGAAAAATAGGGTGG + Intronic
1046182893 8:110675514-110675536 ACCATGCTGGCCAAACATGGTGG + Intergenic
1047572799 8:126118836-126118858 AACATACAGGCCAAATGTGGTGG - Intergenic
1050611023 9:7353917-7353939 AGCATGTAGGCTGAGTGTGGTGG + Intergenic
1051105750 9:13578044-13578066 AACATGCTGTCAAAATATGGAGG + Intergenic
1051364583 9:16312463-16312485 GGCAAGCAGGCTGAATAAGGGGG - Intergenic
1051501686 9:17784998-17785020 AAAATGCAGGCTAAGTGTGGTGG - Intronic
1051554619 9:18368606-18368628 AGAATGCAGGCAAACTTTGGAGG - Intergenic
1055423707 9:76171060-76171082 AGAATGCAGCCTGAATATAGTGG + Intronic
1055951035 9:81730016-81730038 AGCATGCAGGCTAGGCTTGGTGG + Intergenic
1056598806 9:88029876-88029898 AGCAGGCAGGCTGGGTATGGTGG - Intergenic
1061928315 9:133818613-133818635 AGCTTGCAGGCAGCATATGGCGG + Intronic
1187424635 X:19165998-19166020 AGCACGGAGGCTAAAGATTGGGG - Intergenic
1187474562 X:19599676-19599698 AGCATGAAGGCTAAGTTTGATGG - Intronic
1189800368 X:44686271-44686293 AGGATCCAGGCTAAAGAAGGAGG + Intergenic
1189947204 X:46191498-46191520 AGCATGCAGGCTATTCATGAAGG + Intergenic
1194114945 X:89884602-89884624 AGAATGCAGGCCGGATATGGTGG - Intergenic
1195280538 X:103328514-103328536 AGCCTGAAGCCTAAATATGTGGG - Intergenic
1196378721 X:115066091-115066113 AGCAACCAGGCTGAATATGGAGG + Intergenic
1197871094 X:131063550-131063572 AGCATGCAGGATAAATAGAAGGG + Intronic
1199108961 X:143907672-143907694 ACCATGCAGCCTAAGTAAGGTGG - Intergenic
1200324986 X:155228255-155228277 ATCATGCAGGCTAAGTGTAGTGG - Intronic
1200467735 Y:3541693-3541715 AGAATGCAGGCCAGATATGGTGG - Intergenic