ID: 1000172394

View in Genome Browser
Species Human (GRCh38)
Location 5:158714962-158714984
Sequence GCATGCTTGGTTCTAATAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000172388_1000172394 14 Left 1000172388 5:158714925-158714947 CCCTCTTTTTACTTAGGTGGACC 0: 1
1: 0
2: 1
3: 2
4: 111
Right 1000172394 5:158714962-158714984 GCATGCTTGGTTCTAATAATAGG No data
1000172390_1000172394 -7 Left 1000172390 5:158714946-158714968 CCTCCATATTTAGCCTGCATGCT 0: 1
1: 0
2: 1
3: 6
4: 141
Right 1000172394 5:158714962-158714984 GCATGCTTGGTTCTAATAATAGG No data
1000172391_1000172394 -10 Left 1000172391 5:158714949-158714971 CCATATTTAGCCTGCATGCTTGG 0: 1
1: 0
2: 1
3: 6
4: 75
Right 1000172394 5:158714962-158714984 GCATGCTTGGTTCTAATAATAGG No data
1000172389_1000172394 13 Left 1000172389 5:158714926-158714948 CCTCTTTTTACTTAGGTGGACCT 0: 1
1: 0
2: 1
3: 11
4: 167
Right 1000172394 5:158714962-158714984 GCATGCTTGGTTCTAATAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000172394 Original CRISPR GCATGCTTGGTTCTAATAAT AGG Intronic
No off target data available for this crispr