ID: 1000172682

View in Genome Browser
Species Human (GRCh38)
Location 5:158718472-158718494
Sequence TCTGAAGCCTCGTACTGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000172677_1000172682 -10 Left 1000172677 5:158718459-158718481 CCTCTCTCCATCCTCTGAAGCCT 0: 1
1: 0
2: 4
3: 74
4: 457
Right 1000172682 5:158718472-158718494 TCTGAAGCCTCGTACTGAAGGGG No data
1000172676_1000172682 2 Left 1000172676 5:158718447-158718469 CCATGGACAATGCCTCTCTCCAT 0: 1
1: 0
2: 1
3: 25
4: 248
Right 1000172682 5:158718472-158718494 TCTGAAGCCTCGTACTGAAGGGG No data
1000172675_1000172682 3 Left 1000172675 5:158718446-158718468 CCCATGGACAATGCCTCTCTCCA 0: 1
1: 0
2: 2
3: 14
4: 166
Right 1000172682 5:158718472-158718494 TCTGAAGCCTCGTACTGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000172682 Original CRISPR TCTGAAGCCTCGTACTGAAG GGG Intronic
No off target data available for this crispr