ID: 1000173729

View in Genome Browser
Species Human (GRCh38)
Location 5:158729299-158729321
Sequence AGAGTCCACTGGAGGTATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000173729_1000173732 -10 Left 1000173729 5:158729299-158729321 CCTCAATACCTCCAGTGGACTCT 0: 1
1: 0
2: 1
3: 8
4: 124
Right 1000173732 5:158729312-158729334 AGTGGACTCTAGAGATCAAATGG 0: 1
1: 0
2: 0
3: 10
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000173729 Original CRISPR AGAGTCCACTGGAGGTATTG AGG (reversed) Intronic
901430479 1:9211097-9211119 AGAGTCATTTGGAGGTACTGGGG + Intergenic
907641716 1:56197269-56197291 AGACTCTACTGGAGGTCTTAAGG - Intergenic
908479580 1:64525054-64525076 ATGGTCCACTGGTGGTATTATGG - Intronic
910413565 1:86972635-86972657 AGCATCCACTGGGGGTCTTGGGG + Intronic
912201498 1:107463013-107463035 AGAGTCCATTGGAGGTAGGCTGG - Intronic
915129747 1:153688113-153688135 AGAGTCACCTGGAGGAGTTGGGG + Exonic
915671319 1:157491276-157491298 AGAATCCACTGGGGGTGTGGAGG - Intergenic
916831425 1:168495729-168495751 AAAGTACACTGGAGCTATCGAGG - Intergenic
917204357 1:172555248-172555270 AGAGAACACTGGAGGCATAGGGG + Intronic
1062864866 10:843791-843813 AGAGTCTACAGGAGGAATTTTGG - Intronic
1072893932 10:99349510-99349532 AGAATCACCTGGAGATATTGAGG + Intronic
1074892123 10:117744373-117744395 AGAGTGGAATGGAGGCATTGTGG + Intergenic
1075087264 10:119421968-119421990 AGAGTCCACTGGATGGTTTCTGG - Intronic
1075188175 10:120282117-120282139 ACAGTCCAAAGGAGGCATTGTGG + Intergenic
1075718391 10:124570240-124570262 TGAGTCCACTGGTGGCAGTGAGG - Intronic
1082870365 11:57938841-57938863 GGAGGCCACTGGAGGTCATGAGG - Intergenic
1083256849 11:61501848-61501870 GGAGCCTAGTGGAGGTATTGGGG - Intergenic
1086454732 11:86949830-86949852 AGATTTCACTGGAGGCAGTGTGG - Exonic
1087915140 11:103801032-103801054 AATGTGCACTGGAGTTATTGAGG - Intergenic
1090921573 11:131210835-131210857 AGAGACTACTGGAGGTGGTGGGG + Intergenic
1092971421 12:13699253-13699275 ACAATGCACTGCAGGTATTGGGG - Intronic
1096658083 12:53104107-53104129 ACAGTCAACAGGAGGAATTGGGG - Intronic
1096803714 12:54127648-54127670 AGAGGCCGCTGCAGGTGTTGGGG + Intergenic
1104740111 12:131165862-131165884 AGAGTCCCCTGGAGAAATGGAGG + Intergenic
1105455457 13:20536617-20536639 GGAGTCCAGTGGAGTGATTGTGG - Intergenic
1106920406 13:34557147-34557169 AGAGTCAAAGGGAGGTACTGAGG + Intergenic
1108003341 13:45924318-45924340 AGAGTCCCCTGGAGGGTTTGGGG - Intergenic
1112097720 13:96152743-96152765 AGAAGCCATTGGAGGTTTTGGGG - Intronic
1114416641 14:22549308-22549330 AGAGTCCAATGGAGGCAGCGAGG - Intergenic
1114674332 14:24430557-24430579 TGAGTCCACTGGAGGTAGGGAGG - Intronic
1117986090 14:61387450-61387472 AGTGTCCACTGGAGCTGTAGAGG + Intronic
1121078752 14:91090635-91090657 AAAGTCCACTGGTGGCCTTGGGG + Intronic
1121454574 14:94030090-94030112 GGAGTCCACTGGAGGGCATGGGG + Intronic
1127577631 15:60307511-60307533 TGAGCCCACTGGAGGTTTTGAGG + Intergenic
1128477480 15:68009640-68009662 AGAGTCTATTGGAGGTAGGGAGG - Intergenic
1129243352 15:74264974-74264996 AGAGGGCACTGAAGGTGTTGAGG - Intronic
1131596760 15:93805864-93805886 AAAATCCACAGGAGGTATGGAGG + Intergenic
1132165242 15:99580502-99580524 AGAGTCTCCGGAAGGTATTGTGG + Intronic
1134192951 16:12136551-12136573 AGAGTGCACTGGTGTCATTGGGG - Intronic
1134567912 16:15266807-15266829 AGAGACCACTGGAGGAAGTCAGG - Intergenic
1134734523 16:16489546-16489568 AGAGACCACTGGAGGAAGTCAGG + Intergenic
1134932943 16:18222360-18222382 AGAGACCACTGGAGGAAGTCAGG - Intergenic
1135473095 16:22749665-22749687 AGAGCTCACTTGAGGTATGGGGG - Intergenic
1136588788 16:31204539-31204561 GGAGTACACCGGAGGGATTGTGG + Intergenic
1137036276 16:35572611-35572633 ACAGTCCACAGGAGGGCTTGAGG - Intergenic
1138673860 16:58636791-58636813 AGAGTCCAGGGGAGATAGTGCGG + Intergenic
1139470563 16:67175985-67176007 AGAGGCCAGTGGAGGGAGTGGGG + Exonic
1139916777 16:70433248-70433270 AGAGTCCAATTGAGGTATGCAGG - Intronic
1146892277 17:36513854-36513876 AGAGCCCACGGCAGGTATGGGGG + Intronic
1147339873 17:39746950-39746972 AGAGTCCACTGGATGGGTGGAGG - Exonic
1147381920 17:40061422-40061444 AGAGTGCAGTGGTGGTGTTGAGG - Intronic
1151269704 17:72984639-72984661 AGAATCCCCTGGAGGTCTTGCGG - Intronic
1151388973 17:73772843-73772865 AGAGTGCAGTGGAGGCAGTGGGG - Intergenic
1154028428 18:10727702-10727724 AGAGGCCAGTGGAGGGAGTGGGG - Intronic
1154273696 18:12941544-12941566 AGTGTCCAATGGCGGTATTTTGG + Intergenic
1156448083 18:37251551-37251573 AGAGTCAACTAGAGGATTTGGGG - Intronic
1157193795 18:45603422-45603444 AGAGTTCACTGTATTTATTGGGG + Intronic
1158885112 18:61819671-61819693 ATATTCCACTGGAGGTGCTGGGG + Intronic
1160134721 18:76262453-76262475 AGAGCCCACTGGAAGCAGTGTGG + Intergenic
1162514706 19:11141002-11141024 GGAGGCCACTGGAGGTTGTGGGG + Intronic
1164085731 19:21900514-21900536 AGAGTCTGCAGGAGATATTGAGG + Intergenic
1164128538 19:22340582-22340604 ACAGTGCACGGGAGGGATTGTGG - Intergenic
1164206599 19:23064229-23064251 AAAGTCCACAGGAGGAGTTGAGG - Intergenic
1164815670 19:31200554-31200576 AGTGTCCAGTGGAGGAATGGAGG + Intergenic
1165926280 19:39328132-39328154 TGGGTCTCCTGGAGGTATTGGGG - Intergenic
1167091742 19:47349126-47349148 AGAGGCCAGTAGAGGCATTGCGG - Intergenic
928092806 2:28386322-28386344 AGATTTCACTGCAGGTATTCTGG - Intergenic
928718589 2:34092770-34092792 AGAGTCCAATGGAGCTAAAGTGG - Intergenic
929494645 2:42429950-42429972 ACAGGTCACTGGAGGTAATGGGG - Intergenic
937487096 2:122326530-122326552 AGATTCCACTGGAGTGATTAAGG + Intergenic
1173068371 20:39736868-39736890 AGAGACCACTGGAGGTGGGGGGG - Intergenic
1174756715 20:53166185-53166207 AGATTTCTCAGGAGGTATTGGGG + Intronic
1175357943 20:58383839-58383861 TGAGTTCACTGGAGCTATTATGG + Intergenic
1175625586 20:60486096-60486118 AGAGTCCAGAGGAGGCAGTGGGG + Intergenic
1178633465 21:34282194-34282216 GGAGTGCACTGGAGCTATTTAGG - Intergenic
1182044607 22:27264420-27264442 AGAGGCCACTGCAGGTATCGTGG + Intergenic
1183771017 22:39925913-39925935 AGAGTCTCCTGGAGGTGATGAGG - Intronic
954461485 3:50629429-50629451 AGTGCACACTGAAGGTATTGGGG - Intronic
959849048 3:111066991-111067013 AGAGGTCACTGGAGGAAATGTGG - Intergenic
960523490 3:118682393-118682415 AGAGCAAACTGTAGGTATTGAGG - Intergenic
964797856 3:160519470-160519492 AAAGTCTACTAGTGGTATTGTGG + Intronic
965997348 3:174900415-174900437 AGAGTACACTGGTGGTAGTTAGG + Intronic
967074048 3:185986483-185986505 AGAGCCCTCAGGAGGTCTTGGGG + Intergenic
969859073 4:10021506-10021528 AGAGTCCACTGGAAGGAGGGCGG + Intronic
974917055 4:68191037-68191059 TGAGTTCACTAGATGTATTGAGG - Intergenic
975749541 4:77508556-77508578 AGAGTCCCCTGCAGGAGTTGTGG + Intergenic
976953747 4:90867683-90867705 AAAGGCTAGTGGAGGTATTGGGG - Intronic
980751295 4:137092818-137092840 AGATTCCACTGGTGGTGCTGTGG + Intergenic
982464963 4:155718775-155718797 AGAGTGCAGTGGAAGTGTTGCGG - Intronic
983270525 4:165556407-165556429 AGAGTCCACTGGGTGAAGTGAGG - Intergenic
983460154 4:168016970-168016992 AGAGTCCACTGGAGGTGACCTGG - Intergenic
985805596 5:2040327-2040349 GGAGTCCATTGGAGATAATGGGG - Intergenic
986178915 5:5375692-5375714 AGAGTGCACTGGAGGGAAAGGGG + Intergenic
987363113 5:17124384-17124406 AGAGCCTACTGGGGGAATTGAGG - Intronic
989348026 5:40452275-40452297 AGAGTCCACTGTTAGTCTTGGGG + Intergenic
990604768 5:57397666-57397688 GGAATCCACTGGGGGTCTTGAGG + Intergenic
990681085 5:58245150-58245172 AGAGTCTGCTGGAAGTATTGCGG + Intergenic
993493087 5:88576064-88576086 GGAGTCCACAGGAGGTAGAGGGG - Intergenic
994263383 5:97685962-97685984 AGAGTCCCCTGGACATTTTGTGG + Intergenic
996045109 5:118863123-118863145 AGTGTCCACTTGTGTTATTGAGG - Intronic
997529117 5:134571351-134571373 AGAAGCCACTGGAGGTTTTAAGG + Intronic
997851118 5:137333409-137333431 AGTGTCTGCTGGAGGTCTTGTGG - Intronic
998279464 5:140791434-140791456 AGAGTCCTTTGTAGTTATTGGGG - Intronic
1000173729 5:158729299-158729321 AGAGTCCACTGGAGGTATTGAGG - Intronic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1008478250 6:51956940-51956962 AGATTCCACTGGAGGTTTTGAGG + Intronic
1018320441 6:162602606-162602628 AGAGTCCATTGTAGGTATCTGGG + Intronic
1023928669 7:44690443-44690465 AGAGTACATTGGTGGTATAGTGG + Intronic
1024291564 7:47807982-47808004 AGCGTCCCCTGGAGGCACTGGGG + Intronic
1024465725 7:49709833-49709855 AGGGTCCTCTTGAGGTGTTGTGG - Intergenic
1025782831 7:64617064-64617086 ATAGTTCACAGGAGGGATTGAGG + Intergenic
1025784950 7:64635730-64635752 ACAGTCCACAGGATGGATTGAGG + Intergenic
1026454607 7:70559770-70559792 AAAGACCACTGGAGGTAAGGAGG - Intronic
1031558576 7:123208983-123209005 AGAGCCCTCTGGTGGCATTGTGG - Intergenic
1032214512 7:129947380-129947402 AGAGTCCACTGGAAATAAAGAGG + Intronic
1035059738 7:156060044-156060066 AGAGTTCTCTGGAGGTGTGGGGG + Intergenic
1037764803 8:21766063-21766085 AGAAACCACTGGAGGCATTGAGG - Intronic
1038315730 8:26482880-26482902 AGAATCCACTGGAAGGATTCAGG - Intronic
1038685471 8:29713467-29713489 AGAGTCCCTTGAATGTATTGAGG + Intergenic
1040347870 8:46527159-46527181 AGAGTCTACAGGAGATATTTAGG + Intergenic
1040489546 8:47906913-47906935 AGAGGCCAGTGAAGGTATTAGGG - Intronic
1047842328 8:128766766-128766788 AGAGTCCACTGCCAATATTGTGG + Intergenic
1050139282 9:2500690-2500712 AGATTCTAATGGAGGTATTAGGG + Intergenic
1050696535 9:8285716-8285738 GGAGTCCACTGTATGTGTTGGGG - Intergenic
1058378432 9:104352326-104352348 AGAGTCCACTGCATGTGTTTAGG - Intergenic
1058573177 9:106370446-106370468 TGAGTCCACTGGAGGAAGTCTGG + Intergenic
1058818350 9:108706120-108706142 AGAAGCCACTGCAGGTTTTGGGG + Intergenic
1058905118 9:109476627-109476649 AGAGTCCACTGGAGGTTTGAAGG + Intronic
1060481616 9:124019355-124019377 AAAGTCCTTTGGAGGTAGTGTGG + Intronic
1186853430 X:13602674-13602696 TAAGTCCACTGGAGGGAGTGGGG - Intronic
1189271901 X:39757929-39757951 AGAGTCCACTGGATGAATGCGGG + Intergenic
1198590755 X:138178109-138178131 ATAATCCACTGGAGGAATGGAGG - Intergenic
1200702941 Y:6417599-6417621 AGTGTCCAGTGGTGCTATTGAGG + Intergenic
1201031169 Y:9747098-9747120 AGTGTCCAGTGGTGCTATTGAGG - Intergenic