ID: 1000175377

View in Genome Browser
Species Human (GRCh38)
Location 5:158747181-158747203
Sequence CACAACTAAAACTCAAATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000175375_1000175377 21 Left 1000175375 5:158747137-158747159 CCTAAGTGACCAGTGTAAGATCA 0: 1
1: 0
2: 0
3: 12
4: 115
Right 1000175377 5:158747181-158747203 CACAACTAAAACTCAAATGTTGG 0: 1
1: 0
2: 0
3: 35
4: 244
1000175376_1000175377 12 Left 1000175376 5:158747146-158747168 CCAGTGTAAGATCAACAGCTAGT 0: 1
1: 0
2: 0
3: 10
4: 69
Right 1000175377 5:158747181-158747203 CACAACTAAAACTCAAATGTTGG 0: 1
1: 0
2: 0
3: 35
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000175377 Original CRISPR CACAACTAAAACTCAAATGT TGG Intronic
900275988 1:1828695-1828717 CTGAATTGAAACTCAAATGTTGG - Intronic
904766943 1:32857030-32857052 CCTAACTAACACTCAAATTTGGG - Exonic
905355381 1:37380209-37380231 CACACCAAAAACTCATCTGTAGG - Intergenic
905470568 1:38188504-38188526 CACAGCTAAAACTCAAGTCCAGG - Intergenic
906279016 1:44540649-44540671 CACTAATAAAAATCAAATGTAGG - Intronic
906482885 1:46211702-46211724 CAAAACTGGAACTCAAATCTAGG + Intronic
906570398 1:46833110-46833132 CACACCTAACACTCAGATCTTGG - Intergenic
907760267 1:57351181-57351203 CAGAACTGGAACTCAAATCTAGG + Intronic
909308604 1:74115842-74115864 CCCACCAAAAAGTCAAATGTTGG + Intronic
909924168 1:81419062-81419084 CAGAACTAAAGCTCAAAAGTAGG + Intronic
909934401 1:81534033-81534055 CACAACCAGAATTCAAATTTGGG - Intronic
910420119 1:87051620-87051642 CACAATTAAAACTCAAATTATGG + Intronic
911342168 1:96652246-96652268 CACACCAAAACCTCAACTGTAGG + Intergenic
911600170 1:99839965-99839987 AACAACAAAAATTCAAAAGTAGG + Intergenic
911752913 1:101519093-101519115 GACAACTTAAAGTCAAATGGGGG - Intergenic
914384857 1:147158742-147158764 CCAAACTAAAACAAAAATGTAGG + Exonic
916859187 1:168785036-168785058 TAGAACTATAACTCAAATATTGG + Intergenic
918086830 1:181252625-181252647 CCCATCTAAAACTTAAATTTGGG + Intergenic
918437808 1:184534395-184534417 TAGAGCTAAAACTCAAATCTGGG + Intronic
918887582 1:190215292-190215314 CATTACTAAAACTTAAATGTAGG + Intronic
920063868 1:203250293-203250315 AAAAACTAAAACTAAAAGGTAGG + Intronic
920651526 1:207840870-207840892 CAGAACTAAAATTCAAATCCAGG + Intergenic
921241250 1:213186035-213186057 GACAACTAAAACTCAAAATGTGG - Intronic
923467665 1:234263721-234263743 CACTAGTAAATCTCAAGTGTTGG - Intronic
923761132 1:236845273-236845295 CACAAATTAAAAGCAAATGTAGG + Intronic
923784677 1:237055479-237055501 CACAACTACCACCCAAATTTAGG - Intronic
924640943 1:245833234-245833256 CAAAACTAAGAAGCAAATGTTGG + Intronic
924673206 1:246149400-246149422 CAAAACTAAAACTAAAATTGAGG - Intronic
1062794014 10:329150-329172 CCCAACAAAAAATCAAATTTAGG + Intronic
1064436486 10:15315352-15315374 CACAACTAACACTCAAAGTACGG - Intronic
1064468901 10:15615081-15615103 CACAACAAGAACACAAATGCAGG - Intronic
1065203483 10:23336469-23336491 CACATCTAACACTCAGATGTTGG + Intronic
1065290913 10:24228270-24228292 AACAACAAAAAATCAAATATAGG + Intronic
1066381392 10:34905097-34905119 CACAATTAAAACACAAATATGGG - Intergenic
1066789789 10:39049648-39049670 CCCAACTAAAACTTTAATTTGGG + Intergenic
1068495440 10:57779812-57779834 CACAACAAAACCTCATCTGTAGG + Intergenic
1072521001 10:96230041-96230063 CAGATCTAAAACTCACAGGTTGG + Intronic
1073217880 10:101846573-101846595 CAAAACTAAAATTCAAAAGGCGG + Exonic
1073389629 10:103163714-103163736 AAAAAAAAAAACTCAAATGTGGG + Intronic
1073779293 10:106819675-106819697 CACAATTATGACTCAAGTGTGGG - Intronic
1075986809 10:126795126-126795148 CACAACTAACATTCAAATTTTGG + Intergenic
1077743300 11:4872001-4872023 CAAAACTAAAGCTTAAATATAGG - Intronic
1077821263 11:5743836-5743858 AACAACTAAAACCCAAAGCTAGG + Intronic
1078858265 11:15224363-15224385 TACTACTAAAACTAAAAGGTAGG + Intronic
1078982484 11:16552317-16552339 CACTATAAAAACTTAAATGTGGG + Intronic
1081227356 11:40540709-40540731 CACAATAGAAGCTCAAATGTGGG - Intronic
1082592342 11:55027894-55027916 CACAACGAAAACTAAAAGGAAGG - Intergenic
1084357625 11:68650517-68650539 CACAACTAAAATTCAACTGGCGG + Intergenic
1086740276 11:90359425-90359447 CACACCCAATACTCAGATGTTGG + Intergenic
1087059107 11:93961262-93961284 CAGAACTGACACTCAAATGTAGG + Intergenic
1087344146 11:96949103-96949125 CACATCTAACACACAAATCTTGG + Intergenic
1087580299 11:100042196-100042218 CAAAACTAAACCACTAATGTGGG - Intronic
1088394358 11:109350238-109350260 CTCAACTACAATTCAAATGCCGG - Intergenic
1088530399 11:110801806-110801828 CACAATTAACACTCAATAGTTGG + Intergenic
1088698057 11:112386488-112386510 TAAAAGTAAAACTCAAATTTAGG - Intergenic
1090173561 11:124626455-124626477 CAGAACTGAAACGCAAATCTGGG - Exonic
1091676649 12:2495847-2495869 CACACCTAAAACTGAAACTTGGG + Intronic
1093624732 12:21331814-21331836 CACAAGTAAAACTAAAAAATAGG + Intronic
1093883411 12:24432195-24432217 CACAACCAAAATTCAAATCCAGG - Intergenic
1094403318 12:30086154-30086176 CACAACCAAAACTAAACGGTTGG - Intergenic
1095139728 12:38646716-38646738 CACAGCTAAAATGCAAAGGTAGG + Intergenic
1096117454 12:49063473-49063495 CACAGCTAAAAATCACATCTAGG + Intergenic
1097946540 12:65375395-65375417 CTCAACTAAAGCTCCAATGAAGG - Intronic
1098017393 12:66120395-66120417 TACAACTAAAACTGAAATCTGGG - Exonic
1099147684 12:79067310-79067332 CAGAACTTAAAGTCAACTGTAGG - Intronic
1099296506 12:80834665-80834687 CCAAACTTTAACTCAAATGTTGG - Intronic
1099450363 12:82800629-82800651 AAACACTAAAACTCAAATTTTGG - Intronic
1099517298 12:83612890-83612912 CAGAACTAAAAATTACATGTTGG - Intergenic
1100554697 12:95681582-95681604 CTTAACACAAACTCAAATGTGGG - Intronic
1102063253 12:109951456-109951478 CAAAACTAAAACATAAAAGTAGG + Intronic
1102944147 12:116970721-116970743 CACTTCTAAAACTTCAATGTTGG - Intronic
1105655649 13:22434528-22434550 CAAAAGTAAAACTCATCTGTAGG + Intergenic
1107954631 13:45499035-45499057 CACACCTAATACTCAGATCTTGG - Intronic
1108118059 13:47151809-47151831 AAAAACAAAAACACAAATGTGGG + Intergenic
1108353147 13:49605692-49605714 CAGAACTCAAACTCAAACCTAGG + Intergenic
1108505474 13:51108750-51108772 CAGAACTAAAATTCAAATCTTGG + Intergenic
1108838371 13:54580363-54580385 AACAATTAAAAATAAAATGTAGG + Intergenic
1110336325 13:74335270-74335292 CACATCTAGAATACAAATGTAGG - Intergenic
1111402101 13:87751876-87751898 AAAAAATAAAACTCAAATCTGGG - Intergenic
1111863054 13:93732346-93732368 CACAACAAAAAAACAAATATTGG + Intronic
1113046369 13:106159638-106159660 CAGAACTAAAAGGCAAATGAAGG - Intergenic
1114600883 14:23954496-23954518 CAAAACTAAAATACAAATGTAGG + Intronic
1114610563 14:24037208-24037230 CAAAACTAAAATACAAATGTAGG + Intergenic
1115389729 14:32841407-32841429 CACACCTAACACTAAAATCTTGG - Intergenic
1117594767 14:57315034-57315056 CACAGCTCAAACTCAAGGGTTGG + Intergenic
1117788033 14:59307885-59307907 CACATCTAAAACATAAATCTAGG - Intronic
1120364698 14:83551206-83551228 CACAACTAAAAAGCAAAAGTTGG - Intergenic
1120728196 14:87970524-87970546 CAGAACTAATACTAAAATCTGGG + Intronic
1121198092 14:92093185-92093207 CCCATTTAAAACTAAAATGTGGG - Intronic
1126349959 15:47734745-47734767 CACACTTAAAACTCAAACCTAGG - Intronic
1126998323 15:54472312-54472334 CACAACTAAAATTTAAATAATGG - Intronic
1127787015 15:62364703-62364725 CACAACTAAAAACCCAATGAGGG + Intergenic
1128626542 15:69212319-69212341 CACAACTAGAACACAAATCAGGG - Intronic
1129965250 15:79729226-79729248 CAGAACTAAAACTCAGAGATGGG - Intergenic
1130083211 15:80753424-80753446 CAAAACTAAAACACCAACGTTGG - Intronic
1130173301 15:81540170-81540192 GACAACAAAAAGTCAAATGTAGG + Intergenic
1130752306 15:86725109-86725131 CAGAGCTAAAAATTAAATGTGGG + Intronic
1140173767 16:72634920-72634942 CAAAAGTAAAACTCAACTTTAGG + Intergenic
1140427040 16:74869750-74869772 CAGAACTAAATCTCCCATGTTGG - Intergenic
1142441202 16:90098593-90098615 CACATTTGAAACTCAAATGTGGG - Intergenic
1142923075 17:3208083-3208105 CAAAATTAGAACTCAAATCTTGG + Intergenic
1146884251 17:36460393-36460415 CAGAAGTAAACTTCAAATGTTGG - Intergenic
1148805061 17:50259792-50259814 CCGAAATAAAAATCAAATGTGGG + Intergenic
1149116518 17:53103636-53103658 TGCAACTAAAACTCAGATGGTGG - Intergenic
1149930684 17:60751909-60751931 ATCAAGTAATACTCAAATGTGGG + Intronic
1152193150 17:78900785-78900807 CACATCTAAAACTTATATGTGGG + Intronic
1153899885 18:9608708-9608730 CACAACTCTAATTCAAATTTAGG + Intronic
1155191691 18:23436490-23436512 CATAACTAAAAATCAACTGGAGG + Intronic
1155518051 18:26642476-26642498 CAGAACTAAAAATCAAAATTGGG - Intronic
1155725443 18:29075801-29075823 CACAATAAAAACACAAATGCAGG - Intergenic
1156111889 18:33738082-33738104 CTCAACTAAAACTCTACTGCTGG - Intronic
1156180992 18:34604028-34604050 CACAACTATAACACATATTTAGG - Intronic
1156908669 18:42384980-42385002 CAAACCTAACACTCAAATATAGG + Intergenic
1159828791 18:73248051-73248073 TACAAATGAAACACAAATGTTGG + Intronic
1160050617 18:75429939-75429961 GACATCTAAACCTCAAATGAGGG - Intergenic
1161957213 19:7502960-7502982 CACAACTAAATGTCAAATCAGGG - Intronic
1164977567 19:32584904-32584926 CACAATTAAAACACAGCTGTCGG - Intronic
1166428273 19:42699018-42699040 CACAACTAAAGCTCTATAGTTGG - Intronic
1167215780 19:48163639-48163661 AACAACTAAATATAAAATGTTGG + Intronic
925506030 2:4565063-4565085 CACACCTAATGCTCAGATGTTGG - Intergenic
925531167 2:4864250-4864272 CAAAAATACAACTAAAATGTTGG - Intergenic
925673079 2:6332667-6332689 CACACCAAAAACCCAACTGTAGG - Intergenic
926074652 2:9932335-9932357 CACAACAAAACCTCATCTGTAGG - Intronic
926771402 2:16379412-16379434 GACAAGTTAAACTCAAGTGTTGG - Intergenic
927617507 2:24613877-24613899 TACTCCTAAAACTCAAAAGTCGG - Intronic
928295813 2:30082996-30083018 CTCATCTGAAACACAAATGTTGG + Intergenic
928909930 2:36409377-36409399 CACAATTAAGATTAAAATGTGGG - Intronic
929800627 2:45097879-45097901 CATAACTAAAAATCCAATGGAGG + Intergenic
930445949 2:51472451-51472473 AACAACAAAAAATCAAAAGTGGG - Intergenic
930980691 2:57523177-57523199 AACAACTTACACTCAGATGTGGG + Intergenic
931747885 2:65306783-65306805 CCCCAATAAAATTCAAATGTTGG + Intergenic
933256808 2:80090225-80090247 CACAAGCAAAACTCACATGTAGG - Intronic
935829252 2:106983281-106983303 CACAACTAAAAAGCCAATATTGG + Intergenic
938230750 2:129656658-129656680 TGCAACTGAAACCCAAATGTTGG - Intergenic
939431682 2:142117581-142117603 CACAAATAAAAATCCATTGTGGG - Intronic
939712715 2:145542951-145542973 CAATACTAAAACTCAACAGTAGG - Intergenic
941660292 2:168189807-168189829 CAAAGCTAAAACTCTATTGTAGG + Intronic
941861915 2:170291325-170291347 GACAACTAAAAGTCAAAATTTGG - Intronic
943285114 2:185988843-185988865 CACAAATTAAAATGAAATGTTGG + Intergenic
943562077 2:189476230-189476252 CCCCCCTAAAATTCAAATGTTGG + Intergenic
944163870 2:196696103-196696125 CACAGCCAAAACTCAAAAGTAGG - Intronic
945412068 2:209521998-209522020 CATAAATAAAATTCAAATGAGGG + Intronic
945421290 2:209640029-209640051 CAAAACAAAAACAAAAATGTAGG + Intronic
945528735 2:210923685-210923707 CATAACCAGAACTCAAATCTAGG + Intergenic
946529331 2:220554788-220554810 CACATCTAATACCCAGATGTTGG + Intergenic
947128055 2:226892740-226892762 CACCATTAGAACTCAAATTTTGG + Intronic
1169516636 20:6323147-6323169 CACAACTAAAAATCGACTATAGG - Intergenic
1169593036 20:7165621-7165643 CACAACACAAATTCAACTGTTGG + Intergenic
1169628548 20:7599735-7599757 AACAACAAAAAGTAAAATGTGGG + Intergenic
1170139886 20:13115023-13115045 AACAACTAAAACACGACTGTAGG - Intronic
1171037114 20:21723629-21723651 GACAATTAAAAATAAAATGTTGG - Intergenic
1172478189 20:35254454-35254476 CACAACTATACCCCAAAAGTGGG + Exonic
1172622801 20:36330871-36330893 CAAAATAAAAACTCAAAAGTCGG - Intronic
1176815341 21:13595264-13595286 CACATTTAAAAATCAAATCTTGG - Intergenic
1178540836 21:33448343-33448365 CACAACTAAAAAACAAATTCAGG + Intronic
1180072227 21:45442281-45442303 CAAAAATAAAACTCACAGGTGGG - Intronic
1180792844 22:18586194-18586216 CTCAATTAAAAGTCAAATGAGGG + Intergenic
1181228892 22:21409125-21409147 CTCAATTAAAAGTCAAATGAGGG - Intergenic
1181249759 22:21525740-21525762 CTCAATTAAAAGTCAAATGAGGG + Intergenic
1182491444 22:30674844-30674866 CACAAATAAAAGTACAATGTGGG - Intergenic
1183693347 22:39403951-39403973 CACCACTCAAACTCAAAAGAGGG - Intronic
949577594 3:5353662-5353684 CAGAGCTGAAATTCAAATGTAGG - Intergenic
950820784 3:15756228-15756250 CACAACTAAAAATCAACTGCAGG + Intronic
951123213 3:18952608-18952630 CACAGCTAGTACTCAAATATTGG - Intergenic
951807887 3:26666672-26666694 CACAATTAAGACTCCAATATGGG + Intronic
956319312 3:67978661-67978683 CATAACTGAAACTCAAATCACGG + Intergenic
956587068 3:70876147-70876169 CAAAACCAAGACTCAAATATTGG - Intergenic
958266694 3:91446097-91446119 CAAATCTAAAACTCCAATTTAGG + Intergenic
960301069 3:116003215-116003237 CATATCTAAAGCTCAAATGTAGG + Intronic
961306947 3:125964633-125964655 CCCAGCTAAAACCCAAGTGTTGG - Intergenic
962260719 3:133902064-133902086 CTCATCTAAAATTCAAATATGGG - Intergenic
962373980 3:134845180-134845202 CAAAAATAAAACTCAATTCTTGG + Intronic
963106660 3:141653289-141653311 CAAAACTAAGCCTTAAATGTGGG - Intergenic
964791229 3:160454184-160454206 GAGAACTAATACTCAAATGCAGG + Intronic
965751828 3:171983082-171983104 CAAACCAAAAACTGAAATGTTGG + Intergenic
967158727 3:186716933-186716955 CACAACTGAAAATAAAATATGGG - Intergenic
967768462 3:193308462-193308484 AACAAAAAAAAGTCAAATGTAGG + Intronic
968361464 3:198149565-198149587 CACATTTGAAACTCAAATGTGGG - Intergenic
970298113 4:14653104-14653126 CACAACTATAATTAAAATCTAGG + Intergenic
970962870 4:21893615-21893637 CACAAGTAAATTGCAAATGTTGG - Intronic
970967630 4:21947352-21947374 CACAGTTACAAGTCAAATGTGGG + Intronic
971304331 4:25466692-25466714 CCCCACCAAAACTCATATGTTGG - Intergenic
974387645 4:61223620-61223642 AACAAATAAAAATCAAATATAGG - Intronic
975024569 4:69532381-69532403 CATAACCAAACCTCAAAAGTGGG - Intergenic
975385481 4:73754610-73754632 CACAACTAGAACCCAAATCTTGG + Intergenic
976064154 4:81164620-81164642 CACACCTAACACTCTAATGGTGG - Intronic
977024071 4:91793129-91793151 CATAAATAAAACTCAATTCTAGG - Intergenic
978691207 4:111513279-111513301 CACACCCAGAACTAAAATGTAGG - Intergenic
978842300 4:113229222-113229244 CAGAACTAAAACCAAGATGTTGG + Intronic
980182403 4:129417188-129417210 CCCAACCATAACTCAAATCTTGG - Intergenic
980883104 4:138733233-138733255 CATAACAAAAACTCGAATGATGG + Intergenic
981601197 4:146490971-146490993 CACAAAGAAAACTCAAAGATTGG + Intronic
981659407 4:147148236-147148258 CACACCTAACACTCACATCTTGG - Intergenic
981802679 4:148676869-148676891 AACAACTATCACTCAATTGTAGG - Intergenic
983478822 4:168248038-168248060 CACAACTAAAACTGAAAGCCAGG + Intronic
983524562 4:168747915-168747937 CCCAAGTCAAACTCAAATATTGG + Intronic
983554980 4:169051890-169051912 CAGGACTAAAAGTCACATGTTGG - Intergenic
983890903 4:173028966-173028988 AACAACAAATAGTCAAATGTAGG - Intronic
985519439 5:366136-366158 CACACCTAACATTCAGATGTTGG + Intronic
985918241 5:2944650-2944672 TACTTCTAAAAATCAAATGTAGG - Intergenic
986847938 5:11777718-11777740 AAGAACTAAAACTAAGATGTTGG - Intronic
987184830 5:15406344-15406366 AACAACAAAAACTAAAAGGTTGG - Intergenic
987945963 5:24609126-24609148 CAAAACTAAGAATAAAATGTAGG + Intronic
988289083 5:29261512-29261534 CTGAGCTAAAACTCAAATGAAGG - Intergenic
988578425 5:32447900-32447922 CACACCTACAAGTCAAAAGTAGG + Intergenic
989314448 5:40061187-40061209 CACAACTAAAGTTCGAATTTTGG + Intergenic
990909620 5:60840883-60840905 CTTAACTAAAACTCTATTGTTGG - Intronic
993462424 5:88200110-88200132 CATAACTAAAACTACAATATAGG + Intronic
994160420 5:96550388-96550410 CACACCAAAACCTCATATGTAGG + Intronic
995087978 5:108137788-108137810 CAAAATGAAACCTCAAATGTTGG + Intronic
996074152 5:119169635-119169657 CATAAGTAAAAATGAAATGTAGG + Intronic
996110163 5:119556007-119556029 ACCAACTAAAACACAATTGTTGG + Intronic
1000014269 5:157264034-157264056 CACAAATAGAACTCAGAGGTCGG + Intergenic
1000175377 5:158747181-158747203 CACAACTAAAACTCAAATGTTGG + Intronic
1003261351 6:4519087-4519109 CACAACTAAAATTAAACTGAGGG + Intergenic
1005336403 6:24801073-24801095 GACAACTAAAATAAAAATGTAGG + Intronic
1005435713 6:25809579-25809601 CACAATGAAAACTAAAATGTTGG + Intronic
1007960072 6:45950632-45950654 CAAAAGTAGAAATCAAATGTTGG + Intronic
1008988518 6:57575496-57575518 CACATCTAAAACTCCAATCTAGG - Intronic
1009177126 6:60474087-60474109 CAAATCTAAAACTCCAATCTAGG - Intergenic
1009682953 6:66922659-66922681 CAAAACTAAAAATCAATTATTGG + Intergenic
1010205578 6:73319950-73319972 CACACCTAATACTCAGATTTTGG + Intergenic
1010291029 6:74138084-74138106 CACTACAAAAACTCATGTGTTGG + Intergenic
1012473856 6:99600694-99600716 CACAACTAAGAGCCAAATTTAGG - Intergenic
1013032175 6:106344382-106344404 AACAACTAAAAATCTAATTTTGG - Intergenic
1014087997 6:117370509-117370531 CACATCTAAAATTAAAATATAGG - Intronic
1014587190 6:123213250-123213272 CACAACTGAAATCAAAATGTGGG - Intergenic
1014811599 6:125892950-125892972 CCCTACTTAAACTAAAATGTAGG - Intronic
1015176947 6:130320379-130320401 TAAAATTAAAAATCAAATGTTGG + Intronic
1016521016 6:144946728-144946750 CAAAACTAATACTCATATGGAGG - Intergenic
1018078852 6:160241214-160241236 CACTACTAATACTCAAGTATGGG - Intronic
1019254226 7:39155-39177 CACATTTGAAACTCAAATGTGGG + Intergenic
1020595212 7:10198646-10198668 CACAATTAAAAATCAGCTGTTGG + Intergenic
1021152789 7:17172444-17172466 AGCAACTCAAACTCAAATGTAGG + Intergenic
1023330540 7:39111197-39111219 CAAACCTAAAACTGATATGTTGG - Intronic
1024498862 7:50079124-50079146 CACATTTAAAAATCCAATGTTGG + Intronic
1027414149 7:77957341-77957363 CATAACAAAATCTAAAATGTTGG - Intronic
1027874585 7:83752588-83752610 AACAACTAAAACTAAAATGAGGG + Intergenic
1028034879 7:85969535-85969557 CAGTTCTAAAAATCAAATGTTGG + Intergenic
1028618330 7:92795948-92795970 CTCAAATAACACTTAAATGTAGG - Intronic
1031504706 7:122567666-122567688 CATAACAATAACTCAAATGATGG + Intronic
1032155606 7:129465107-129465129 CAGAATTATATCTCAAATGTTGG - Intronic
1036212505 8:6853824-6853846 CACACCAAAAACTCAAATCTAGG - Intergenic
1037033009 8:14132281-14132303 CAAAAATAAAACTGAAATGCTGG - Intronic
1038352986 8:26797760-26797782 CTCAATAAACACTCAAATGTAGG - Intronic
1039271488 8:35886059-35886081 TACAGCTAGAATTCAAATGTAGG + Intergenic
1039770061 8:40676824-40676846 TAGAAATAAAGCTCAAATGTGGG + Intronic
1040460727 8:47645304-47645326 AACAGCTAAAAATCAGATGTGGG + Intronic
1042419831 8:68573219-68573241 CACAACTGAAATTCAAGTGTTGG - Intronic
1042857413 8:73281712-73281734 CACAAGTAGAAATCAACTGTGGG + Intergenic
1043745905 8:83873059-83873081 CACAACTAAATTTCTAATTTAGG + Intergenic
1045960257 8:107959121-107959143 CCCAACTAAAACACATTTGTGGG - Intronic
1046249486 8:111611661-111611683 CACAACTAAAACTCAAGCAGAGG - Intergenic
1046420049 8:113969503-113969525 TACAACAAAAACTTAAATGATGG - Intergenic
1046664920 8:116990490-116990512 CACAAGCAAAAATCAAATCTAGG + Intronic
1048388157 8:133933021-133933043 CACACCTAACACTCAGATCTTGG - Intergenic
1050681933 9:8121595-8121617 CATATCTAAAAATCAAATGAGGG - Intergenic
1050710317 9:8454316-8454338 CACAAACAAAACTCAGATATTGG + Intronic
1051060244 9:13037267-13037289 CACAACAACTACACAAATGTGGG - Intergenic
1051131912 9:13871902-13871924 CAGAATTAAAACTGAAATATAGG - Intergenic
1051878699 9:21817872-21817894 AGCAACTAAAACTAAAATTTAGG - Intronic
1052090521 9:24321288-24321310 AACAACATAAGCTCAAATGTGGG - Intergenic
1052764962 9:32631728-32631750 CTGACCTAAAACTGAAATGTGGG - Exonic
1055636652 9:78285682-78285704 CACAATTAAAACAAAAATCTTGG + Intergenic
1056925773 9:90833396-90833418 CAGAACTAAAACTCTAAGGTGGG + Intronic
1059752196 9:117258384-117258406 CACAACTCAGACTCAAAAGTGGG + Intronic
1062235207 9:135504641-135504663 CAAAAATAAAACTCAGATTTGGG + Exonic
1062746176 9:138213386-138213408 CACATTTGAAACTCAAATGTGGG - Intergenic
1187833235 X:23404444-23404466 CACAACAAAGAGTCAAATGTCGG + Intergenic
1188326386 X:28807749-28807771 ATAAACTAAAAATCAAATGTAGG - Intronic
1192387675 X:70689378-70689400 CACAACTAACATTCAGATCTTGG + Intronic
1192401421 X:70839470-70839492 CACATCAAAAACTCATCTGTAGG + Intronic
1192567531 X:72177952-72177974 CCCAACGAAAAATCAAAAGTAGG + Intergenic
1193197477 X:78650605-78650627 AAAAACTAAAACTAAAATCTAGG + Intergenic
1194003764 X:88464923-88464945 AACAACAAAAACTCCACTGTTGG - Intergenic
1196201792 X:112894775-112894797 CTCAACCAAAACTGAAATGGTGG + Intergenic
1197367196 X:125578765-125578787 CACATCTAAATATCAAATATGGG + Intergenic
1198712157 X:139516802-139516824 CACAACTTAAACACTAATGATGG + Intergenic
1198775585 X:140175856-140175878 CACAACTAAATCTCAAAAGCTGG - Intergenic
1200738557 Y:6828243-6828265 CACAAATGAAATTCAAGTGTGGG + Intergenic