ID: 1000180014

View in Genome Browser
Species Human (GRCh38)
Location 5:158799773-158799795
Sequence GCTAGGCCTGCATTTTTATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000180014_1000180020 -6 Left 1000180014 5:158799773-158799795 CCCCATAAAAATGCAGGCCTAGC 0: 1
1: 0
2: 2
3: 5
4: 125
Right 1000180020 5:158799790-158799812 CCTAGCATCGTCTGGGTTTCTGG No data
1000180014_1000180021 16 Left 1000180014 5:158799773-158799795 CCCCATAAAAATGCAGGCCTAGC 0: 1
1: 0
2: 2
3: 5
4: 125
Right 1000180021 5:158799812-158799834 GTGATCTTTCCAAAGAAGCCAGG 0: 1
1: 0
2: 2
3: 19
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000180014 Original CRISPR GCTAGGCCTGCATTTTTATG GGG (reversed) Intronic
902497991 1:16888080-16888102 TGTAGGCCCGCATTTTTATCTGG - Intronic
906959133 1:50404930-50404952 GCCTGGCCTAAATTTTTATGAGG + Intergenic
907612821 1:55889608-55889630 ACTAGGTCTGCACTCTTATGGGG - Intergenic
908016473 1:59843164-59843186 GCTATGCCTGCCTTTGTTTGGGG - Intronic
908540428 1:65116985-65117007 GCTAGCCCTGAATTTTTAGAAGG + Intergenic
909909739 1:81246308-81246330 GCAAGTCCTGCTTTTCTATGGGG + Intergenic
911132465 1:94403438-94403460 GCTAGGAGTGAATTTTGATGAGG - Intergenic
913026021 1:114841295-114841317 GAAAGCCCTGGATTTTTATGTGG + Intergenic
916229202 1:162522604-162522626 GGTAGTCCTGCATTCATATGTGG - Exonic
916637288 1:166686373-166686395 CCTTTGCCTGCATTTTAATGGGG + Intergenic
919059021 1:192607271-192607293 GCTATGCCTGCATTGTGATGGGG - Intergenic
922049747 1:221977854-221977876 GCAAGTCCTGCTTTTCTATGGGG - Intergenic
923533693 1:234831668-234831690 ACTATGCCTGCTTTTTTTTGGGG - Intergenic
923946347 1:238892550-238892572 CCAGGGCCTGCATTTTTATATGG - Intergenic
924294012 1:242567174-242567196 ATTAGGCTTCCATTTTTATGAGG - Intergenic
924889692 1:248261271-248261293 CCTTTGCCTACATTTTTATGGGG - Intergenic
1066366631 10:34783250-34783272 GATTGGCCTCCATTTTTATTTGG + Intronic
1067675893 10:48376548-48376570 GCTTCGCCTGCTTTTTGATGGGG - Intronic
1071314663 10:84382899-84382921 GGTATGCCTTCATTTTCATGAGG + Intronic
1073562085 10:104505715-104505737 GCTTGGCCAGCAGTTTTTTGAGG - Intergenic
1074364880 10:112849854-112849876 GCCAGGGCTGCCTTTTTCTGTGG - Intergenic
1074942085 10:118245922-118245944 GCTGAGCCTGCATTCTTATACGG - Intergenic
1078079787 11:8195529-8195551 GCAAGTCATGCATCTTTATGTGG + Intergenic
1079497320 11:21060436-21060458 GCTATGCCATCATTATTATGGGG + Intronic
1079906455 11:26253840-26253862 GCTACTCCTTAATTTTTATGAGG + Intergenic
1082742630 11:56927469-56927491 GCTAGACCTGGAATTTCATGTGG + Intergenic
1087591921 11:100200334-100200356 GCTAAGCCTGTCTTTTTATATGG - Intronic
1090664659 11:128906492-128906514 GCGAGGCCAGCATTCTCATGTGG + Intronic
1092249275 12:6883594-6883616 GCTAGGCATGCATTTTTCTTGGG + Intronic
1094011916 12:25818877-25818899 GCTAACCCTGGATATTTATGAGG + Intergenic
1096340341 12:50793098-50793120 ACTAGAGCTGCATCTTTATGTGG + Intronic
1096629720 12:52918351-52918373 AGTAGGCCTGCATGTTTCTGAGG - Intronic
1097329083 12:58313506-58313528 GGTAGGCCAGCATTTTGTTGAGG + Intergenic
1098447088 12:70576903-70576925 GCCACTACTGCATTTTTATGGGG + Intronic
1101007766 12:100418062-100418084 GCTATGCCAGCATTCTCATGGGG + Exonic
1102222101 12:111201555-111201577 ACTACGCCTGCATATTTGTGTGG + Intronic
1104739061 12:131159361-131159383 GATAGGCCTGTATGTTTGTGTGG - Intergenic
1105448409 13:20476722-20476744 GCTGAGCCTGCGTTTTTAAGAGG - Intronic
1107281542 13:38741767-38741789 TCTAGGCATGCATTTTTATGAGG + Intronic
1108257589 13:48625646-48625668 GCTAGGTAAGCATCTTTATGAGG - Intergenic
1109660571 13:65454072-65454094 AACAGGCCTGCAGTTTTATGTGG - Intergenic
1111066779 13:83104550-83104572 GCTAGGCCTGCTTTTTTCTGTGG - Intergenic
1111918146 13:94383177-94383199 GCTTGGCCTGGATTTTCATAGGG + Intronic
1112167053 13:96931104-96931126 GGTAGGCATCCATTTTCATGTGG + Intergenic
1114754624 14:25245515-25245537 GCTAGGCCAGCCTCCTTATGTGG + Intergenic
1118307700 14:64669099-64669121 GCAATGCCTGCATGTTTTTGTGG + Intergenic
1118681889 14:68250297-68250319 AATGTGCCTGCATTTTTATGTGG + Intronic
1120537596 14:85715845-85715867 GCTAGGCCAGTCTTTTCATGGGG + Intergenic
1123826791 15:24090370-24090392 ACTATGCCTGCATTTTCAGGTGG - Intergenic
1123841391 15:24251227-24251249 ACTATGCCTGCATTTTCAGGTGG - Intergenic
1123851284 15:24359826-24359848 ACTATGCCTGCATTTTCAGGTGG - Intergenic
1124397804 15:29319867-29319889 GCTGGGGCTGCAGTTTTAGGGGG + Intronic
1127174463 15:56338938-56338960 GGTAGGCCTGAATCTTTATAGGG + Intronic
1127581236 15:60340905-60340927 GCCAGGACTGAATTTCTATGTGG + Intergenic
1128791634 15:70438752-70438774 TCTTGCCCTGCATTCTTATGTGG - Intergenic
1129819640 15:78589714-78589736 GATAGGCCTGCTTTTATATTAGG + Intronic
1130947681 15:88561210-88561232 GCAAGTCCTGCTTTTCTATGGGG - Intergenic
1134194436 16:12148288-12148310 GCTAGGTCGCCATTTTTAAGTGG - Intronic
1138298019 16:55903290-55903312 GCTAGGCATGTCCTTTTATGAGG - Intronic
1140449742 16:75061034-75061056 AGTAGGTATGCATTTTTATGGGG + Intronic
1142833489 17:2566854-2566876 GGTAGGCCTGCATTCTTTTCTGG - Intergenic
1146756109 17:35433229-35433251 GCGTGGCCTGCATTTCTATTGGG + Intronic
1147685530 17:42284693-42284715 GCTAGCCCACCATTTTTCTGCGG - Intergenic
1150204599 17:63393273-63393295 TCTAGTGCTGCATTTTTATAAGG - Intronic
1151049292 17:70958439-70958461 CCTTGGCCTGCTTTTTAATGGGG + Intergenic
1151719841 17:75848774-75848796 GCTGGGCCTGCACTGTGATGGGG + Intronic
1153916511 18:9750427-9750449 GCCAAGCCTGCATTTTTACAAGG - Intronic
1161293312 19:3507007-3507029 GCTGGGACTGCATTTTACTGGGG - Intronic
931009748 2:57896600-57896622 GCTATGCCTGGCCTTTTATGTGG + Intergenic
931188300 2:59975009-59975031 GCAAGACCTGCATTGTTAAGAGG + Intergenic
933995129 2:87662588-87662610 CCTGGGCCTGCATTTTAAAGAGG + Intergenic
936298732 2:111288325-111288347 TCTGGGCCTGCATTTTAAAGAGG - Intergenic
940001115 2:148967013-148967035 GCTAGGCCTGCATTCTGAAGTGG - Intronic
943675204 2:190710424-190710446 CCTAGGCCAGCATTTTTTTCAGG + Intergenic
943922046 2:193720953-193720975 GCTAGGCCTGCATTCTGGTTTGG - Intergenic
944393933 2:199247927-199247949 GCAAGTCCTGCTTTTCTATGGGG + Intergenic
944581011 2:201132878-201132900 TCTAGGCTTGCTGTTTTATGAGG + Intronic
946662545 2:222016609-222016631 GGAAGGTCTGCAATTTTATGTGG - Intergenic
1179531503 21:42022589-42022611 TCTTGGCCTGCATCTTCATGCGG - Intergenic
1182212345 22:28687102-28687124 GGTAGACCTGTATCTTTATGAGG + Intergenic
1183218404 22:36496153-36496175 GCTGGGCCAGCATCTGTATGGGG + Exonic
952094445 3:29932213-29932235 GCTAAGCCTGCATTTTTGATGGG - Intronic
953179220 3:40580982-40581004 GCTTTGCCTGCATTTATCTGTGG + Intergenic
955491913 3:59491300-59491322 CCTTTGCCTACATTTTTATGGGG + Intergenic
956048011 3:65217176-65217198 GCTAAGCCTGCATTATGATCTGG - Intergenic
957773752 3:84728817-84728839 GCTAGGCCTGAATTCATAAGGGG - Intergenic
964683378 3:159366973-159366995 GCTAGATCTTCATTTTTAGGAGG - Intronic
968072734 3:195796723-195796745 TCTTAGCCTGCATTTTTTTGTGG - Intronic
970862924 4:20723970-20723992 TCAAAGCCTTCATTTTTATGGGG + Intronic
971099990 4:23455569-23455591 GCTAAGCTTGCATTGTAATGAGG + Intergenic
973970861 4:56212562-56212584 GCTATGCCTACATTTACATGTGG - Intronic
976386650 4:84467392-84467414 GCTGGGCCTGCATTTTCCTCTGG + Intergenic
984670937 4:182486636-182486658 TCTAGCTCTGCATTTTTCTGTGG - Intronic
988096585 5:26619967-26619989 GATAGAACTTCATTTTTATGAGG + Intergenic
992763940 5:79977656-79977678 ACTAGGCCTGCAATTTTGAGAGG - Intronic
998987694 5:147780222-147780244 GCTAGACCTGTATTTCTATCAGG + Intronic
1000180014 5:158799773-158799795 GCTAGGCCTGCATTTTTATGGGG - Intronic
1001639781 5:173236184-173236206 GCTAGGCCAGGATTTCTCTGAGG + Intergenic
1002943949 6:1743252-1743274 GCTAGACATCCATTTTGATGTGG - Intronic
1002976431 6:2082453-2082475 CCCATGCCTGCAATTTTATGAGG - Intronic
1006208151 6:32368541-32368563 GGTAGGCCTGCATAATTCTGAGG - Intronic
1009159660 6:60266369-60266391 GCTTGCCCTTCATTCTTATGTGG + Intergenic
1011630739 6:89321520-89321542 GCTAGGCATGCATATTTGTCAGG + Intergenic
1012169547 6:96001965-96001987 GCTAGTCCTGCAGATTGATGTGG - Intergenic
1014975624 6:127878508-127878530 ACTAGGCCTTCAGGTTTATGGGG + Intronic
1016996200 6:149963908-149963930 CCTAGGCATGCACTTTTTTGGGG - Intergenic
1021579452 7:22137531-22137553 CTTAGGCCTGAATTTTTATTTGG - Intronic
1023117106 7:36873347-36873369 GCCAGGCTAGCATTTTGATGAGG + Intronic
1023300948 7:38770298-38770320 GCTTGGCCTGCTTGGTTATGTGG - Intronic
1024841119 7:53588740-53588762 GCTTAGCCTGCATTTATAAGTGG - Intergenic
1026361964 7:69610323-69610345 GGTAGGCCTGCATTTTAAATGGG - Intronic
1028332194 7:89608642-89608664 GGCAGGCCTGCATTTTCATCTGG - Intergenic
1032969843 7:137148219-137148241 GGTAGGACTGCATTTTCATCTGG + Intergenic
1038927072 8:32152873-32152895 AATAGGCATGCATTTTTAAGAGG + Intronic
1040478214 8:47799592-47799614 GCTGGGCTTGCATTTTTGTTTGG - Intronic
1041026803 8:53695015-53695037 GCTTGGCCTACTTTTTGATGGGG + Intergenic
1041266495 8:56070569-56070591 GCTTGGCCTGGCTTTTTTTGTGG - Intronic
1041497494 8:58503078-58503100 GCCAGGCCTTCAGTTTTATAAGG + Intergenic
1046768260 8:118093314-118093336 TATAGGCCTGTATTTGTATGTGG - Intronic
1047242493 8:123104701-123104723 CCTATACCTTCATTTTTATGGGG - Intronic
1047930930 8:129727870-129727892 GCTACAGCTGCAGTTTTATGTGG + Intergenic
1048122447 8:131596938-131596960 GCTAGGCCTGTCTTTATTTGAGG + Intergenic
1052129886 9:24830666-24830688 GCTAGCCCTGCAATTTTCTCGGG - Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1189646415 X:43137601-43137623 TCTAGGGCTACAGTTTTATGAGG - Intergenic
1190535360 X:51421194-51421216 CCTAGGGCTTCAGTTTTATGGGG + Intergenic
1190798152 X:53763012-53763034 GCTTTGCCTGCATATATATGTGG + Intergenic
1194150114 X:90314477-90314499 GCTATGCATGCATTTTAATTTGG - Intergenic
1195537297 X:106023377-106023399 GGTATGCCAGCATTTTTATGAGG - Intergenic
1197345728 X:125324649-125324671 GCTCTGCCTGCATTTTTGTGAGG - Intergenic
1197371414 X:125630131-125630153 ACTAGGACTCCATTTTTATCTGG - Intergenic
1198113074 X:133519945-133519967 GCTAGGGCTGCATTTATCTCAGG + Intergenic
1200496539 Y:3891556-3891578 GCTATGCATGCATTTTAATTTGG - Intergenic