ID: 1000184108

View in Genome Browser
Species Human (GRCh38)
Location 5:158842245-158842267
Sequence GTAGCCCTGCTGATCACACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000184106_1000184108 -4 Left 1000184106 5:158842226-158842248 CCCAGAAGGCAAGTGCTGGGTAG 0: 1
1: 0
2: 3
3: 19
4: 198
Right 1000184108 5:158842245-158842267 GTAGCCCTGCTGATCACACATGG 0: 1
1: 0
2: 2
3: 12
4: 136
1000184107_1000184108 -5 Left 1000184107 5:158842227-158842249 CCAGAAGGCAAGTGCTGGGTAGC 0: 1
1: 0
2: 0
3: 6
4: 126
Right 1000184108 5:158842245-158842267 GTAGCCCTGCTGATCACACATGG 0: 1
1: 0
2: 2
3: 12
4: 136
1000184102_1000184108 24 Left 1000184102 5:158842198-158842220 CCTTTGCACTGTCTTGTTGGTCT 0: 1
1: 0
2: 0
3: 23
4: 234
Right 1000184108 5:158842245-158842267 GTAGCCCTGCTGATCACACATGG 0: 1
1: 0
2: 2
3: 12
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000184108 Original CRISPR GTAGCCCTGCTGATCACACA TGG Intronic
900946388 1:5833542-5833564 GAAGTCCTGCTGATCTCCCAGGG - Intergenic
904286931 1:29458968-29458990 GTCCCTCTGCTGATCACTCAGGG - Intergenic
905301187 1:36987215-36987237 GGAGCTCTGCTGAGCAGACATGG - Intronic
905301193 1:36987261-36987283 GGAGCTCTGCTGAGCAGACATGG - Intronic
905301199 1:36987307-36987329 GGAGCTCTGCTGAGCAGACATGG - Intronic
907971610 1:59388251-59388273 GAAGCCATGCTGGTCACACTTGG + Intronic
909989881 1:82210549-82210571 ATAGTTCTGCTGATCATACAAGG - Intergenic
915087586 1:153398626-153398648 GGAGCACTGCTGATCTGACAGGG - Intergenic
915936546 1:160093139-160093161 GTAGCCCAGCTGGACACAGAGGG - Exonic
921223212 1:212989464-212989486 GAAGACCTGCTGATCACTCCTGG - Exonic
924024539 1:239818550-239818572 GTAGCCCTGCTTCTCACACAGGG + Intronic
1076729112 10:132429515-132429537 GTAGGCCTGCTGCCAACACAGGG + Intergenic
1076881928 10:133243800-133243822 GGAGCCCAGCTGATCACCCTGGG - Intergenic
1077246931 11:1544214-1544236 GAACTCCTGCTCATCACACAAGG + Intergenic
1078270825 11:9793213-9793235 ACAGCCCTGCCTATCACACAGGG - Intronic
1084802742 11:71555503-71555525 GCAGCCAGGATGATCACACAGGG + Intronic
1090277361 11:125429511-125429533 GTAGCCATTCTGACCCCACAGGG + Intronic
1091157956 11:133391178-133391200 GTGGCCCTGCTGAGCATCCATGG + Intronic
1097517926 12:60629020-60629042 GTAGCTCTGCTTATCTAACAGGG - Intergenic
1102911288 12:116716118-116716140 GTAGTCCTGCTGCAAACACATGG + Exonic
1113345868 13:109478095-109478117 ATAGCCCTGGAGCTCACACAAGG - Intergenic
1113558634 13:111258563-111258585 GTACCACTGCTGATTACTCAGGG - Intronic
1114179685 14:20355406-20355428 GTAGACCTGTTGACCACTCAGGG - Intronic
1115691336 14:35847118-35847140 GTAGCCAGGCTGGTGACACATGG - Intronic
1120690926 14:87591518-87591540 GTAGCCCTGCTGCTTGCAGAAGG + Intergenic
1122111545 14:99506769-99506791 GTTGCTCTGCTGGTCTCACATGG + Exonic
1129874520 15:78964608-78964630 GTTGCCATGTGGATCACACAGGG - Intronic
1129922771 15:79334391-79334413 TCACCCCTGCTGCTCACACATGG - Intronic
1132206538 15:99989737-99989759 GAAGCCCTACTGATAAGACAAGG + Intronic
1138179281 16:54931197-54931219 GTAGCCCTGCGGATAGGACATGG - Exonic
1138302808 16:55946764-55946786 GCAGCTCTGCTGATCTCACTTGG + Intronic
1140208472 16:72952342-72952364 GTAGCCCTACTGAGAAGACATGG - Intronic
1140614190 16:76640189-76640211 ATAGCCCTGCTGATCAAAACAGG - Intergenic
1140971868 16:80021133-80021155 GTGACTCTGCTGACCACACAGGG + Intergenic
1142503950 17:351064-351086 GTACCCCTGCCCATCACCCACGG + Intronic
1144642262 17:16944034-16944056 AAAGCCCTGCTGCTCACACATGG - Intronic
1146210422 17:30938200-30938222 GTAGCCCAGCTGATGCCACATGG - Intronic
1150399741 17:64847616-64847638 GTAGGCCTGCGGATCAGCCAGGG - Intergenic
1151468204 17:74301406-74301428 GTGGCCCAGCTGAACACAGAGGG + Intronic
1152587208 17:81194425-81194447 GGAGCCCTGCACATCACCCAAGG + Intronic
1152934999 17:83131477-83131499 GGAGCCCTGATGATAACACAGGG - Intergenic
1153298475 18:3571275-3571297 ATTGCCCTGCTGATCACTAATGG - Intronic
1155181676 18:23353731-23353753 GTAGGCCTGCTGCTTACCCACGG - Intronic
1155577731 18:27266232-27266254 GTAGCCTTGATAATCACACGTGG - Intergenic
1155764461 18:29610094-29610116 ACGGCCCTGCTGATCAAACAGGG + Intergenic
1158424143 18:57323806-57323828 GCAGCCCTGCTGATTCCTCATGG - Intergenic
1159038749 18:63302820-63302842 TTAGCCCTGCAAATAACACAAGG + Intronic
1160586396 18:79915717-79915739 TTAGCCCAGGTGATCTCACAGGG + Intronic
1160739539 19:679688-679710 GCAGCCCCGCTGCTCAGACAGGG - Intronic
1161038933 19:2099773-2099795 GTGGCCCACCTGAGCACACATGG + Intergenic
1161576535 19:5057701-5057723 GCTGCCCTCCTGATCCCACAGGG - Intronic
1162596131 19:11630613-11630635 CTACCCCTGCTGATCACTCAGGG - Intergenic
1164291157 19:23869764-23869786 GCAGCACTGCTGTTCACAAACGG + Intergenic
1166427688 19:42693980-42694002 GTATCCCTGGTGCCCACACAGGG - Intronic
926046431 2:9712990-9713012 ATAACTTTGCTGATCACACACGG - Intergenic
927443206 2:23134574-23134596 CCAGTCCTGCAGATCACACAAGG + Intergenic
927856926 2:26533705-26533727 CTAGCCCTGCTGAGCCCACTCGG + Intronic
929320486 2:40538192-40538214 CTAGCCCTGCCTATCTCACAGGG - Intronic
931123902 2:59252363-59252385 GCAGCCCTTCTGGCCACACAAGG - Intergenic
935557462 2:104526045-104526067 GTGGCCCTGCTCAACACAAATGG + Intergenic
937503726 2:122512778-122512800 CTAACACTGCTGATCACATAAGG - Intergenic
937979949 2:127608999-127609021 GCAGCCCTGCTGGTCCCACACGG + Intronic
940114346 2:150192007-150192029 GTAGCCGTGAGGATCAGACATGG + Intergenic
942026269 2:171913606-171913628 GTAGGCCTGCTTATCACAGAAGG - Intronic
942951175 2:181723655-181723677 GTATCACAGCTGATAACACAAGG - Intergenic
947115601 2:226767241-226767263 TTAGCCTTGCTGATAACACTTGG - Intronic
1170645191 20:18191493-18191515 GTAGCCTTGCTGCTCATATAAGG + Intergenic
1173733299 20:45343032-45343054 CTAGCTCTGCTGCTCACCCAGGG - Intronic
1175346978 20:58286778-58286800 GAAGCCCTGCTCACCACGCAGGG + Intergenic
1175583297 20:60117166-60117188 ATAACCCTGATCATCACACAAGG - Intergenic
1178688842 21:34733779-34733801 ATAGCACTGCAGATGACACAAGG + Intergenic
1179233438 21:39525595-39525617 GAAGACCTCCTGATCACTCATGG + Intergenic
1179383910 21:40924311-40924333 TGAGCCCTGCTCATCACCCAAGG + Intergenic
1183952487 22:41359400-41359422 GAAACCCTCCTAATCACACAAGG - Exonic
1184156261 22:42669524-42669546 GTATCCCAGCTGATGCCACATGG - Intergenic
1184378174 22:44128242-44128264 GTCGTCCTGCTGGTCACTCACGG + Intronic
1185362747 22:50418790-50418812 CCAGCCCTGCTGGGCACACAGGG - Intronic
950534323 3:13570522-13570544 GCAGCCCTGCTGCACACACGTGG - Exonic
951738312 3:25892635-25892657 GTATCCCTGCTGTTAGCACAAGG - Intergenic
954665424 3:52248870-52248892 CTAGCACTGCAGAGCACACAGGG - Intronic
961171888 3:124802969-124802991 GGACCCCTGCTGTTCCCACAGGG + Intronic
963859115 3:150288820-150288842 GTAGTACAGCTGATCACAGAAGG - Intergenic
965625383 3:170679251-170679273 GGGGCCCTGCTGCTCACTCATGG + Intronic
965757028 3:172038163-172038185 TCAGCCCAGCTGATCACTCATGG - Intergenic
967306944 3:188068477-188068499 GTAGCCCTGCTCATCCATCAGGG + Intergenic
968466726 4:755425-755447 GTAGCCCTGCAGCTCACATAAGG - Intronic
970180174 4:13383860-13383882 GCAGTCCTGCCTATCACACAGGG + Intronic
975574848 4:75852460-75852482 GGAGGCCAGCTGATAACACATGG - Intergenic
981382632 4:144090784-144090806 TTAGCTCTGCTGTTCACAGATGG - Intergenic
981418298 4:144519237-144519259 TTAGCCCTTCTGATGACACTAGG + Intergenic
984693027 4:182750424-182750446 GGAGGCCAGCAGATCACACATGG - Intronic
985967909 5:3351712-3351734 GCCGCCCTGCTTTTCACACATGG - Intergenic
992537203 5:77719122-77719144 GTTGCCCTGCTTACCACGCAGGG - Intronic
992558859 5:77930313-77930335 GGAGCCCTGGTGTTCACACTTGG + Intergenic
992813007 5:80408191-80408213 TCAGCCCTGCTGTTCCCACAGGG + Intronic
993992445 5:94676366-94676388 CTAGTCCTGCCGATCACACCAGG + Intronic
995540997 5:113186211-113186233 TCAGCCCTGCTTCTCACACAGGG + Intronic
996089797 5:119339615-119339637 GTAGCACTGCAGATCACAAAGGG + Intronic
996897769 5:128504916-128504938 CTAGCCCTGCTGTTGACTCATGG - Intronic
997124562 5:131212815-131212837 GAAGACTTGCTGATCAAACAAGG + Intergenic
1000184108 5:158842245-158842267 GTAGCCCTGCTGATCACACATGG + Intronic
1000907702 5:166982682-166982704 GTAGCCCTGATGTACTCACAAGG + Intergenic
1002700401 5:181120240-181120262 GAAAACCTGCTGATCAAACAAGG - Intergenic
1004884553 6:20039089-20039111 GTGCTCCTGCTGATCACAAATGG - Intergenic
1005513286 6:26531066-26531088 GTTACCATGCTAATCACACATGG - Intergenic
1008312145 6:49989695-49989717 GTATCACTGCTGATTACTCAAGG - Intergenic
1011388550 6:86824080-86824102 GTAGGCCTGGTGAGTACACAAGG - Intergenic
1013975522 6:116074014-116074036 GTAGCTTTGCTGATCATGCAGGG - Intergenic
1019999393 7:4746732-4746754 GCAGCCCTGCTGAAAACACACGG - Intronic
1022818396 7:33935249-33935271 GTAGGTCTGCTGTTCACAAAGGG + Intronic
1026659269 7:72285004-72285026 GAAGCCCTGCAGAACACACAGGG - Intronic
1027674687 7:81143155-81143177 GTACCCCTGCTGATTATTCAGGG - Intergenic
1031133666 7:117862121-117862143 GCAGCCCAGATGACCACACATGG - Intronic
1031593771 7:123624694-123624716 GTAGCTCTGCTGCTGAAACATGG + Exonic
1035363313 7:158328610-158328632 GGGGCCCTGCTCCTCACACAAGG - Intronic
1036178869 8:6566386-6566408 ATGGCCTTGCTGACCACACACGG - Intronic
1036178879 8:6566478-6566500 ATGGCCTTGCTGACCACACACGG - Intronic
1036178892 8:6566570-6566592 ACGGCCTTGCTGATCACACATGG - Intronic
1036178901 8:6566616-6566638 ATGGCCTTGCCGATCACACATGG - Intronic
1036178916 8:6566708-6566730 ATGGCCTTGCCGATCACACACGG - Intronic
1036178926 8:6566800-6566822 ATGGCCTTGCGGATCACACACGG - Intronic
1036178933 8:6566850-6566872 ATGGCCTTGCTGATCACACATGG - Intronic
1036178940 8:6566896-6566918 ATGGCCTTGCCGATCACACATGG - Intronic
1036178947 8:6566942-6566964 ATGGCCTTGCCGATCACACACGG - Intronic
1036178960 8:6567034-6567056 ATGGCCTTGCCGATCACACATGG - Intronic
1036178967 8:6567080-6567102 ATGGCCTTGCCGATCACACACGG - Intronic
1036178974 8:6567126-6567148 ATGGCCTTGCCGATCACACACGG - Intronic
1036178982 8:6567172-6567194 ATGGCCTTGCTGATCATACATGG - Intronic
1036546584 8:9776368-9776390 GTTTCCCTGCTTATGACACATGG + Intronic
1036635332 8:10546610-10546632 GAAGCCCTCCTGGTCGCACATGG + Intronic
1036713325 8:11097440-11097462 CCAGCACTGCTGAACACACAGGG + Intronic
1038848708 8:31253877-31253899 ATAGCCCTGCTGTCTACACATGG + Intergenic
1040594525 8:48824757-48824779 GTGACCCTGCTGAAAACACATGG - Intergenic
1041892645 8:62888306-62888328 CTAGCCCTGCTGAGGGCACAAGG + Intronic
1042001964 8:64134235-64134257 GTGGCCATTCTGCTCACACATGG - Intergenic
1043927000 8:86048646-86048668 GCAGCCATGGTGATCACCCAGGG + Exonic
1044283686 8:90386199-90386221 GTAGCTCTTCTGATCCCCCACGG + Intergenic
1049383544 8:142329646-142329668 GTGGACCTGCTGGTCACACCTGG - Intronic
1049950208 9:636338-636360 TTAGCACTGCTGATCATGCAGGG + Intronic
1050865215 9:10489125-10489147 GTATCACTGCTGATCACTCGGGG + Intronic
1051253663 9:15189215-15189237 GTAGACCTGCATGTCACACAGGG + Intronic
1058097560 9:100880198-100880220 GAGGCCTTGCTGATCCCACAGGG - Intergenic
1058919665 9:109601368-109601390 ATGGCCATGCTGATCACCCATGG - Intergenic
1060006299 9:120003005-120003027 TCAGCCCTGCTGATCTCAAATGG + Intergenic
1185514512 X:689030-689052 ACAGCCATGGTGATCACACATGG - Intergenic
1188062087 X:25613490-25613512 GTAGACCTGCTGATCTCACATGG - Intergenic
1188353234 X:29158107-29158129 GTAGCACTGCTAATCAAATAAGG - Intronic
1194095738 X:89636624-89636646 GTATCACTGCTGATTACTCAGGG - Intergenic
1199530076 X:148836814-148836836 GTGTCCCTGCTGATAACACAGGG + Intronic
1200448740 Y:3297996-3298018 GTATCACTGCTGATTACTCAGGG - Intergenic
1202136680 Y:21672718-21672740 GTAGCAATGCTGATCAAGCAAGG + Intergenic