ID: 1000186190

View in Genome Browser
Species Human (GRCh38)
Location 5:158860506-158860528
Sequence GGTGGCTCCTGTCCACATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 342}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000186190_1000186194 1 Left 1000186190 5:158860506-158860528 CCACCATGTGGACAGGAGCCACC 0: 1
1: 0
2: 1
3: 38
4: 342
Right 1000186194 5:158860530-158860552 CTCACGATTTCCACTGAGATAGG No data
1000186190_1000186197 19 Left 1000186190 5:158860506-158860528 CCACCATGTGGACAGGAGCCACC 0: 1
1: 0
2: 1
3: 38
4: 342
Right 1000186197 5:158860548-158860570 ATAGGACTTGGCTGCCATCTTGG 0: 1
1: 0
2: 2
3: 12
4: 148
1000186190_1000186195 7 Left 1000186190 5:158860506-158860528 CCACCATGTGGACAGGAGCCACC 0: 1
1: 0
2: 1
3: 38
4: 342
Right 1000186195 5:158860536-158860558 ATTTCCACTGAGATAGGACTTGG No data
1000186190_1000186198 24 Left 1000186190 5:158860506-158860528 CCACCATGTGGACAGGAGCCACC 0: 1
1: 0
2: 1
3: 38
4: 342
Right 1000186198 5:158860553-158860575 ACTTGGCTGCCATCTTGGCATGG 0: 1
1: 0
2: 0
3: 22
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000186190 Original CRISPR GGTGGCTCCTGTCCACATGG TGG (reversed) Intronic