ID: 1000186455

View in Genome Browser
Species Human (GRCh38)
Location 5:158863292-158863314
Sequence CTGTCGGGAGGAACTTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000186455_1000186462 9 Left 1000186455 5:158863292-158863314 CCTTCCCAAGTTCCTCCCGACAG 0: 1
1: 0
2: 2
3: 6
4: 120
Right 1000186462 5:158863324-158863346 ATCCCACCTCAGTTTTCCAACGG 0: 1
1: 0
2: 1
3: 51
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000186455 Original CRISPR CTGTCGGGAGGAACTTGGGA AGG (reversed) Intronic
901111618 1:6801365-6801387 ATGTCTGGAGGAACTGAGGATGG + Intronic
901231400 1:7643442-7643464 GTGTCGAGAAGAATTTGGGAAGG - Intronic
902728693 1:18354140-18354162 CTGTCTGGAAAAACCTGGGAAGG + Intronic
903425733 1:23252870-23252892 GTGTGGGGAGGGACATGGGAGGG + Intergenic
903440672 1:23385758-23385780 CTGGCATGGGGAACTTGGGAAGG - Intronic
903731040 1:25495538-25495560 CTGTAGGGAGGGAGTGGGGAAGG - Intronic
906638238 1:47424756-47424778 CTGTCAAGAGGAAGTGGGGAGGG - Intergenic
908356880 1:63330512-63330534 CTGTTGAGAGGAAAGTGGGAGGG - Intergenic
909185721 1:72482852-72482874 CTGTCGGCAGTAACTTTGAAAGG + Intergenic
914420276 1:147522554-147522576 ATGTCTGAAGGAACTGGGGAAGG - Intergenic
1063559325 10:7111977-7111999 CTGAGGGTTGGAACTTGGGAAGG + Intergenic
1065458910 10:25934885-25934907 CTTTAGGGGTGAACTTGGGAAGG + Intronic
1065967630 10:30782378-30782400 CTGTCTGGAGGGACCTGGGCGGG - Intergenic
1068365172 10:56038565-56038587 CTGTCAGGAAGAACATGGGGTGG + Intergenic
1071341854 10:84656564-84656586 TTGTTGGTAGGAACTTGGAAGGG + Intergenic
1072346129 10:94508652-94508674 ATGGCGGAAGGAACATGGGATGG - Intronic
1072947060 10:99819890-99819912 CTGTTGGCAGGTCCTTGGGAAGG - Intronic
1073760780 10:106626194-106626216 CTGAGGGTAGGAACTGGGGAGGG + Intronic
1075417846 10:122278634-122278656 CTGGAGGAAGGAACTGGGGAAGG - Intronic
1075488917 10:122849581-122849603 GATTCGAGAGGAACTTGGGATGG - Intronic
1077464428 11:2726865-2726887 CTGCTGGGAGCTACTTGGGAGGG - Intronic
1078634097 11:13032886-13032908 CTCTTGGGAGGATCCTGGGATGG + Intergenic
1082783205 11:57302490-57302512 CTGGCAGGAGGGCCTTGGGAGGG + Exonic
1083333370 11:61909359-61909381 CTGTCCTCAGGACCTTGGGAAGG + Intronic
1083747977 11:64745630-64745652 CAACAGGGAGGAACTTGGGAGGG + Intergenic
1085749598 11:79149728-79149750 CTGTCGGGTTGATCTTGGGCTGG + Intronic
1087102645 11:94380276-94380298 CTGAAGGAAGGAACTGGGGAGGG + Exonic
1089354939 11:117843482-117843504 CTGTCAGAATGAACTAGGGATGG - Intronic
1089561092 11:119343578-119343600 CGGTGGGGAGGAACTGGGGCAGG + Intronic
1090473500 11:127000371-127000393 CTGTGGGCAGGAACGTGGGCAGG - Intronic
1091917953 12:4282736-4282758 CTGCTGGGAGGAGCTGGGGAGGG - Intronic
1092080666 12:5713478-5713500 CTGTTTGGAGGAACTTTGGCAGG + Intronic
1097823786 12:64154345-64154367 GGGTGGGGAGGAGCTTGGGAAGG + Exonic
1099360301 12:81692364-81692386 CTGTGGGTAGGAATTTGGCACGG - Intronic
1101840064 12:108321742-108321764 GTGTGGGGAGGAGCTAGGGAAGG - Intronic
1104846336 12:131849046-131849068 GTGTCGGGAGGATATGGGGACGG - Intronic
1107286171 13:38795135-38795157 CTGAAGGGAGGAAATTGGCATGG + Intronic
1108474582 13:50801206-50801228 CAGTGGAGAGGAATTTGGGAGGG + Intronic
1111210789 13:85076492-85076514 CTGTCAGGAGGAAGTTATGAAGG - Intergenic
1113822616 13:113225765-113225787 CTGTCCAGATGCACTTGGGATGG + Intronic
1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG + Intronic
1121224575 14:92311894-92311916 CTGTTGGGAGGTGCTGGGGAGGG + Intergenic
1128695904 15:69762645-69762667 CTGTCTGAAGGAACCTGGGCAGG - Intergenic
1131294425 15:91134562-91134584 CTGTCTGGAGCAACTTGGGAAGG + Intronic
1132547179 16:538678-538700 CTGTGGGGAGGAACCAGGGAAGG + Intronic
1132858137 16:2056591-2056613 CTGTGGGGAGGAGCTGGGGTAGG + Intronic
1136367853 16:29817051-29817073 ATGGCGGGAGGAAATAGGGAGGG + Intronic
1136508486 16:30721493-30721515 CTGTGGTGAGGGACTTGAGATGG + Intronic
1140946721 16:79775391-79775413 CTGTCTGGAATAGCTTGGGATGG + Intergenic
1141423799 16:83932877-83932899 CTGGCAGGATGACCTTGGGAAGG + Intronic
1141684776 16:85563970-85563992 CTGACGGGAGGTGCTTGGGAAGG - Intergenic
1141863073 16:86731145-86731167 ATCTCTGGAGGAAGTTGGGAAGG - Intergenic
1149567692 17:57651652-57651674 CAGGCAGGAGGCACTTGGGACGG - Intronic
1151225964 17:72648663-72648685 CAGTGGGGATGATCTTGGGAAGG + Intronic
1151235918 17:72719789-72719811 CTGTCGCCAGGGACTTGGGTGGG + Intronic
1153331976 18:3882785-3882807 CTGTCAGAAGGAACTTGGTCAGG - Intronic
1158897512 18:61928831-61928853 CTCTCAGGAGGAGGTTGGGATGG - Intergenic
1160239781 18:77114869-77114891 CTGCAGGGAGGAAGTGGGGAAGG + Intronic
1160812618 19:1019498-1019520 CTGCAGGGAGGAAGGTGGGAAGG + Intronic
1160928737 19:1559807-1559829 CGGTAGGGAGGACCCTGGGAGGG + Intronic
1161120767 19:2525117-2525139 CTGCAGGGAGGCAGTTGGGAGGG - Intronic
1161604862 19:5209092-5209114 GTGTTGGGTGGAACTCGGGACGG - Intronic
1163831849 19:19550760-19550782 CAGCCGGGAGGAACTGGGGTGGG - Intergenic
1167435470 19:49476206-49476228 ATGTTGGGAGGGACCTGGGATGG + Intronic
1168397620 19:56062409-56062431 TTGTGGGGAGGAATTTGGGGAGG + Intergenic
925588579 2:5487574-5487596 CTGGAGGGAGAGACTTGGGACGG + Intergenic
926793834 2:16602566-16602588 CCATCTGGAGGACCTTGGGAAGG - Intronic
931806023 2:65805172-65805194 CTGCGGGGAGGAAGTGGGGATGG + Intergenic
932290531 2:70573807-70573829 CTGTGGGAAGGAATTTGGGAAGG - Intergenic
932562919 2:72888234-72888256 ATATCTGGAGGAACTTGGGAGGG + Intronic
933802760 2:85976296-85976318 CTGTTGGGAGGACCTTGGCAGGG + Intergenic
934045618 2:88170605-88170627 CGGACTTGAGGAACTTGGGAGGG + Intronic
934047484 2:88184926-88184948 CTGTCTGAAGGAAGTAGGGAGGG + Intronic
936113995 2:109687715-109687737 CTGACCTGAGGAACTTTGGAAGG - Intergenic
947856680 2:233328841-233328863 CTGTCCCGAGGGACTGGGGAAGG + Intronic
1172006021 20:31819653-31819675 ATGGAGGGAGGAGCTTGGGAAGG + Intronic
1172275789 20:33678354-33678376 CTGTGGGGAGGCACCAGGGAGGG + Intronic
1172439571 20:34955948-34955970 CTGGCGGATGGACCTTGGGAAGG + Intergenic
1174447814 20:50602297-50602319 CTGGCTGGAGGAACTTAGGAGGG - Exonic
1174506019 20:51018137-51018159 CTGTGGGGTGGGATTTGGGAGGG + Intronic
1175795185 20:61766468-61766490 CTGTCGGAAGAAACCTGAGAAGG - Intronic
1175887140 20:62298656-62298678 CTGTCGGGCGGCACATGTGATGG + Intergenic
1180032919 21:45224504-45224526 CTGTGGGGAGGAACTGGGTTCGG + Exonic
1180182287 21:46123374-46123396 CTGTGGGGAGGACATTGGGGAGG - Intronic
1182242226 22:28925192-28925214 ATGTAGGGAAGATCTTGGGAAGG - Intronic
1182297520 22:29318487-29318509 CTGTCGGGAGGGACTTGGGGAGG + Intronic
1183074887 22:35420565-35420587 CTGTCTGGAGGAAGATGGTATGG + Intronic
1183667342 22:39253504-39253526 GGGTGGGGAGGAACCTGGGAGGG - Intergenic
955852072 3:63231320-63231342 CTGGTGGGAGGAGGTTGGGAGGG + Intronic
966871304 3:184291936-184291958 GTTTTGGAAGGAACTTGGGAGGG + Intronic
975669462 4:76766386-76766408 CTGTAGGCAGGAAGTGGGGAAGG + Intronic
981014586 4:139960691-139960713 ATGTCAGGAGGACCCTGGGAAGG - Intronic
982136072 4:152275569-152275591 CTGTTGGGAGCAAGTGGGGAGGG - Intergenic
985805384 5:2039265-2039287 CTGTGGGAAGGGACTGGGGAAGG - Intergenic
987323553 5:16792557-16792579 CTGTGGGGAGGGACTGGGGTTGG - Intronic
996669268 5:126098132-126098154 CTGGCTGGAGGAATTTTGGAAGG - Intergenic
999368885 5:151040763-151040785 CTGACGGGAGGAACTGTGAAAGG + Intronic
999692235 5:154158053-154158075 CTGAAGGAAGGAAATTGGGAAGG - Intronic
1000186455 5:158863292-158863314 CTGTCGGGAGGAACTTGGGAAGG - Intronic
1006734870 6:36266441-36266463 CTGTCAGGAAGAAAATGGGATGG + Intronic
1007587541 6:43000802-43000824 CTGTGGGGAGGAGCCTGGGCAGG + Intronic
1007589932 6:43014764-43014786 CTGTTGGGTGGAGCTTGGAATGG + Intronic
1015669244 6:135669122-135669144 CTGTGGGGAGGAAGTGGGGCAGG - Intergenic
1026072910 7:67138601-67138623 GTGTTGGGAGGAAGGTGGGATGG - Intronic
1026703970 7:72673615-72673637 GTGTTGGGAGGAAGGTGGGATGG + Intronic
1026744312 7:72999150-72999172 CTGTGGGCAGGAACATGGAAGGG - Intergenic
1027030418 7:74883823-74883845 CTGTGGGCAGGAACATGGAAGGG - Intergenic
1027099425 7:75365942-75365964 CTGTGGGCAGGAACATGGAAGGG + Intergenic
1027347418 7:77275640-77275662 CTGTCTTGATGAAGTTGGGAGGG - Intronic
1029378679 7:100198465-100198487 CTGTGGGCAGGAACATGGAAGGG + Exonic
1031070782 7:117159348-117159370 CTATGGGGAAGAACATGGGATGG - Intronic
1032416780 7:131741612-131741634 CTGTTGGGAGGAGCTGAGGAAGG - Intergenic
1034549021 7:151808734-151808756 CTGTGAGGAGAGACTTGGGAGGG - Intronic
1036003857 8:4639185-4639207 ATGTGGGAAGTAACTTGGGAAGG - Intronic
1037326366 8:17695060-17695082 CTGTCAGCAGTAACTTGGGTTGG - Intronic
1038029718 8:23627210-23627232 CTTTCAGTAGGGACTTGGGAGGG + Intergenic
1038248821 8:25883933-25883955 ATGACAGGAGGAACCTGGGAAGG - Intronic
1041173458 8:55169320-55169342 CTGCAGGGAGGAAGGTGGGAAGG + Intronic
1042164639 8:65933750-65933772 ATGTTGGGAGGCACTAGGGAGGG + Intergenic
1046576915 8:116041096-116041118 CTGTGGGGAGAAAATTGGGGAGG - Intergenic
1050395018 9:5186334-5186356 CTGTCTTGAGGTACCTGGGATGG + Intergenic
1052393847 9:27913738-27913760 CTGTCGGGAGGAAGGGAGGAAGG - Intergenic
1055604185 9:77950592-77950614 CTCTAGGGAGGAAATGGGGAAGG + Intronic
1057547767 9:96030928-96030950 CTGTCCGGAGGCACCAGGGAGGG - Intergenic
1057717191 9:97503920-97503942 CTGTAAGGAGGAGCTGGGGAAGG + Intronic
1060903438 9:127281998-127282020 CTGCCTGGGGGAACTGGGGAAGG - Intronic
1196626620 X:117884470-117884492 CTGACGGGGGGAGGTTGGGAAGG + Intergenic
1197821905 X:130549875-130549897 CTGTGGGGAGGGGCGTGGGATGG + Intergenic
1200065395 X:153502199-153502221 CTGTGGGGAGGGGCTGGGGAAGG - Intronic