ID: 1000187488

View in Genome Browser
Species Human (GRCh38)
Location 5:158873727-158873749
Sequence GGCCAAAGTCCTTGTTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000187488 Original CRISPR GGCCAAAGTCCTTGTTTGGT GGG (reversed) Intronic
905061472 1:35143309-35143331 GGGCAAATACCTTGTTTGTTTGG + Intergenic
907460746 1:54604082-54604104 GGCCTGCGTCCCTGTTTGGTAGG + Intronic
908404116 1:63797196-63797218 GCCCAAAGTCCTTTTTTGCAAGG - Intronic
911872222 1:103112468-103112490 GGCCATATTCCTTGTTTGTTTGG - Intergenic
911979412 1:104547895-104547917 TGCCAAAGTCATTGCTTGTTAGG + Intergenic
915064655 1:153214911-153214933 CCCCAAAGTCCTTCTGTGGTAGG - Intergenic
919265476 1:195258779-195258801 GGCCAATGTATTTATTTGGTAGG - Intergenic
920084768 1:203407124-203407146 GGCCAAAGTCCTTATCCTGTTGG + Intergenic
921816486 1:219569754-219569776 GCCCAACTTCCATGTTTGGTTGG - Intergenic
923292242 1:232557477-232557499 GGTTGAAGTCATTGTTTGGTGGG - Intronic
1063207772 10:3850898-3850920 GGCAAAAGTTCTTGCTTGGCGGG + Intergenic
1063387909 10:5627883-5627905 GGTCAAAGTGCTGGTGTGGTTGG + Intergenic
1067529102 10:47057674-47057696 GTCCACAGTCCTAGTTTGGGTGG - Intergenic
1068847902 10:61701494-61701516 AGCTAAAGTCCTTGTTTTCTAGG - Intronic
1071351121 10:84746398-84746420 GGAAAAAGTCCTTGTTTTTTAGG - Intergenic
1073179182 10:101573767-101573789 GGGCAAAGTCCATGTTGGGTGGG + Intronic
1083270162 11:61568100-61568122 GGGCAAAGTTCTTGTTTGGGTGG - Intronic
1084084062 11:66846734-66846756 CCCCAAAGTCCTAGTGTGGTTGG + Intergenic
1086839535 11:91667663-91667685 GGCCAAACTCTTTGTTATGTGGG + Intergenic
1091443966 12:532885-532907 AGCCAAAGTCCTTGACTGTTGGG - Intronic
1101531536 12:105577630-105577652 GGGCCAGGTCCTTGTTAGGTCGG - Intergenic
1105016513 12:132788963-132788985 GGCCAAAGTGCTTGTCGGGAGGG - Intronic
1109654798 13:65375308-65375330 CCCCAAAGTCATTTTTTGGTAGG + Intergenic
1111638382 13:90934775-90934797 GACCAAACTCCTTGGTTGGTTGG - Intergenic
1112308831 13:98300098-98300120 GGCCAAATTCTGTGTGTGGTTGG - Intronic
1114884793 14:26834940-26834962 GGCCAAACTTTTTCTTTGGTGGG - Intergenic
1116331811 14:43606010-43606032 GGGCAAATTCATTTTTTGGTGGG + Intergenic
1117583417 14:57175607-57175629 TGCCAAAGTGGTTGTTTGCTTGG - Intergenic
1119724410 14:76913550-76913572 CCCCAAAGTCCTTGTCTGATAGG + Intergenic
1122526638 14:102390591-102390613 GGCCAAATTGCCTGTTTAGTGGG + Intronic
1123099099 14:105783724-105783746 GGCCAAAGTCCTGTTTTGCTAGG + Intergenic
1123725792 15:23100307-23100329 GACCAAAGTCCCTCTTTGTTTGG + Intergenic
1132624936 16:887194-887216 GGCCCAAATCCTTGCTGGGTGGG + Intronic
1135272986 16:21084982-21085004 GGTCAAAGTCCTAGTTAGGCTGG + Intronic
1140684668 16:77421980-77422002 AGCCAAACATCTTGTTTGGTGGG - Intronic
1145997408 17:29112612-29112634 GGCCACAGGCCTAGTTTGTTTGG - Intronic
1146301297 17:31691720-31691742 GGCCTTAGTCCTTGCTTGCTTGG + Intergenic
1146435806 17:32846126-32846148 GGACAAAGCCCATGTTGGGTAGG - Intronic
1148250726 17:46077392-46077414 GGTGAAAGTGCTTGTTTTGTTGG - Intronic
1150217979 17:63480814-63480836 GGCCACAGTGCTTGTTTCCTTGG - Intergenic
1150816989 17:68400231-68400253 GGCCAGTGTCCTTGGTAGGTTGG - Intronic
1155396446 18:25391307-25391329 GGCAAGGGTCCTTCTTTGGTTGG + Intergenic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1161156939 19:2736847-2736869 GTCCAAACCCCTTGTTTGGCCGG + Intronic
1164939792 19:32243606-32243628 TGCCTTAGCCCTTGTTTGGTTGG + Intergenic
929778122 2:44941117-44941139 GGCCAAGGTCGGTGCTTGGTGGG + Intergenic
930011189 2:46939991-46940013 AGCTCCAGTCCTTGTTTGGTGGG - Intronic
930274309 2:49293754-49293776 GACCAAAGTCCTCATTTTGTAGG - Intergenic
938653359 2:133406786-133406808 GGCCAAAGTCAGTGTTTTCTGGG - Intronic
940446682 2:153785501-153785523 GGCCAGACTCTTTGTTTTGTGGG + Intergenic
943584710 2:189724507-189724529 GGTCAAGGACCTTGTTTTGTTGG + Intronic
1170859917 20:20093328-20093350 GGGCATAGTCGTTGGTTGGTGGG + Intronic
1176133902 20:63510872-63510894 GGTCAAGGTTTTTGTTTGGTTGG + Intergenic
1176369988 21:6056791-6056813 GGCCACAGCCCTTGCTGGGTAGG - Intergenic
1179141891 21:38733019-38733041 GCCTAAAGTGCTTGTTTGATGGG - Intergenic
1179753531 21:43481750-43481772 GGCCACAGCCCTTGCTGGGTAGG + Intergenic
951505918 3:23444830-23444852 GGCCTAAGACAGTGTTTGGTGGG + Intronic
954879749 3:53825336-53825358 GGTTAAAGTCCCTGTTTGATGGG - Intronic
960571019 3:119185364-119185386 GGTCAAAGTCCTAGTTTTGTAGG - Intronic
973218342 4:47697293-47697315 GGGTAAAGTCCATGTTGGGTTGG - Intronic
974021045 4:56692773-56692795 GGCCATGGTCCTTGTGTGCTTGG - Intergenic
981272325 4:142859484-142859506 GGCCAAAGTCCATGTGAGCTAGG + Intergenic
986200334 5:5573410-5573432 TGACACAGTCCTTGTGTGGTGGG + Intergenic
988936934 5:36093320-36093342 TCACAAAGTCCTTGGTTGGTTGG - Intergenic
992760978 5:79950712-79950734 GGCCAAAGTGCTTTTTGAGTTGG - Intergenic
993333485 5:86628223-86628245 AACCAATGTACTTGTTTGGTTGG - Intergenic
997133052 5:131296224-131296246 GGCCAAAATCCTGTTTTGATTGG + Intronic
998558299 5:143147402-143147424 GACCAAAGCCCTTGTGGGGTAGG - Intronic
999243630 5:150141577-150141599 GACCAACGTGCATGTTTGGTTGG + Intronic
999309891 5:150545166-150545188 GAGGCAAGTCCTTGTTTGGTTGG + Intronic
1000187488 5:158873727-158873749 GGCCAAAGTCCTTGTTTGGTGGG - Intronic
1013595405 6:111656087-111656109 GGCCACAGTCTTTGTTTTTTGGG - Intergenic
1013768616 6:113601636-113601658 GGCCAAAGTCATTCTTTCATAGG - Intergenic
1013830555 6:114267671-114267693 GGCCAAATTGGCTGTTTGGTTGG - Intronic
1014281561 6:119447571-119447593 GGCCAGAGCCTTTGTTTGCTTGG - Intergenic
1016516120 6:144894686-144894708 GGCCAGAGTCCTTGTTTAATTGG + Intergenic
1020937057 7:14479570-14479592 GGCCAACTTCCTGGTTTGCTAGG + Intronic
1022889140 7:34677821-34677843 GGCCAAAATCCTTTTTTGTGAGG - Intronic
1028027659 7:85866816-85866838 GGCCAAACTGCTTCTTTGGGTGG + Intergenic
1031185268 7:118471995-118472017 TCCCAGAGTCCTGGTTTGGTTGG + Intergenic
1031210959 7:118825555-118825577 GGCAAATGTCTGTGTTTGGTTGG - Intergenic
1033594029 7:142841601-142841623 GGCCAAAGTTCTTTTCTAGTAGG - Intergenic
1034168642 7:149045551-149045573 GGAGAATGTCCTTGTTTGGAGGG + Intergenic
1036142754 8:6223528-6223550 GGCCAATTTCCATGTTAGGTAGG - Intergenic
1036512762 8:9415871-9415893 GGCAGAAGTCCTTGTGAGGTAGG - Intergenic
1038695318 8:29801418-29801440 GGCTAAAATCTGTGTTTGGTTGG - Intergenic
1039742359 8:40394287-40394309 GGCCACAGTTCTTGCTGGGTTGG + Intergenic
1043653536 8:82631471-82631493 GGCCACAGCTCTTGTTTGGTTGG + Intergenic
1045461972 8:102433249-102433271 GTCCAGAGTTTTTGTTTGGTTGG - Intergenic
1047974873 8:130120173-130120195 GGTCAAAGTCCTTTTTAGGATGG + Intronic
1048974264 8:139662309-139662331 GGCCAAAGGCCTGGCTTGCTAGG + Intronic
1050944703 9:11501653-11501675 GGCCAAAGGCCTGGTTTGAGGGG + Intergenic
1055129082 9:72753928-72753950 GGCCAAAGGCCTACTTTGGGAGG + Intronic
1056283689 9:85066908-85066930 AGCCAAGGTTCTTGTTAGGTAGG - Intergenic
1057770342 9:97961842-97961864 GTCCCAAGTCCTTGTATGGCAGG - Intergenic
1059175259 9:112164384-112164406 GCCCAAAGTCCTTGTTTTAAAGG - Intronic
1059599998 9:115766802-115766824 GCCCAAAGTCCTTATTTATTCGG - Intergenic
1189371109 X:40430241-40430263 GGCCTCTGTCCTTGGTTGGTTGG + Intergenic
1191217771 X:57951389-57951411 GGCCAGAAGCCTTGTTTGGTGGG - Intergenic
1193776213 X:85645504-85645526 GGCCCAAGGCCTTTTTTGGTTGG - Intergenic
1195139764 X:101947650-101947672 GATCAAAATCTTTGTTTGGTGGG - Intergenic