ID: 1000188254

View in Genome Browser
Species Human (GRCh38)
Location 5:158881989-158882011
Sequence CTGCTTTGTATTTGCAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000188252_1000188254 14 Left 1000188252 5:158881952-158881974 CCCTAGTTGCTTCTGCTTAAAAA 0: 1
1: 0
2: 2
3: 28
4: 330
Right 1000188254 5:158881989-158882011 CTGCTTTGTATTTGCAAAGAAGG No data
1000188253_1000188254 13 Left 1000188253 5:158881953-158881975 CCTAGTTGCTTCTGCTTAAAAAT 0: 1
1: 0
2: 1
3: 33
4: 290
Right 1000188254 5:158881989-158882011 CTGCTTTGTATTTGCAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000188254 Original CRISPR CTGCTTTGTATTTGCAAAGA AGG Intronic
No off target data available for this crispr