ID: 1000189600

View in Genome Browser
Species Human (GRCh38)
Location 5:158897255-158897277
Sequence TGTCCTTTGCGGGACATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 2, 1: 14, 2: 38, 3: 52, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000189596_1000189600 15 Left 1000189596 5:158897217-158897239 CCATGGAATACTATGCAGCTATA 0: 436
1: 25124
2: 14091
3: 8335
4: 5529
Right 1000189600 5:158897255-158897277 TGTCCTTTGCGGGACATGGATGG 0: 2
1: 14
2: 38
3: 52
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000189600 Original CRISPR TGTCCTTTGCGGGACATGGA TGG Intronic
901539343 1:9905310-9905332 TGGCTTTTGGGAGACATGGATGG - Intronic
902086951 1:13870280-13870302 TGTCCTTTGCAGGACACAGGAGG - Intergenic
906020290 1:42622240-42622262 TGTCATTTGCAATACATGGATGG - Intronic
906870900 1:49479607-49479629 TGTCCTTTGCATGACATGGATGG - Intronic
908206255 1:61852998-61853020 TGTCATTTGGGGGGCAGGGAGGG - Intronic
911710590 1:101067106-101067128 CCTCCTTTGCAGGACATGGATGG - Intergenic
913715061 1:121525204-121525226 TGTCCTTTGTAGGAAATAGATGG + Intergenic
914994258 1:152527576-152527598 TGTCTTTTACAGAACATGGATGG - Intronic
915763990 1:158344428-158344450 TGCCCTTTATAGGACATGGATGG - Intergenic
916373849 1:164129963-164129985 TGTCTTTTCAGGAACATGGATGG + Intergenic
919204586 1:194405750-194405772 TGTTCTTTGCAGGACATGGATGG + Intergenic
919598744 1:199596594-199596616 TGTCCTTTGCAGGAAATGGATGG - Intergenic
921055285 1:211538438-211538460 TGCCCTTCAGGGGACATGGATGG - Intergenic
921298846 1:213730075-213730097 TGTTCTTTACTGGACATGGATGG - Intergenic
923739778 1:236644744-236644766 TGTCCTTTCAGGGACGCGGATGG - Intergenic
1063666465 10:8063591-8063613 TTTCCTTTGAGGGAAATGAATGG + Intronic
1065700014 10:28415732-28415754 TGTCTTTTGCGGAACATGGATGG - Intergenic
1069935792 10:71915228-71915250 TGGCCTTAGCAGGACATGGGTGG - Intergenic
1070053985 10:72916476-72916498 TGTCCTTTGCAGGGAGTGGATGG - Intronic
1073952948 10:108831848-108831870 TGTCCTTTCCAGGACATGGATGG + Intergenic
1074022718 10:109600824-109600846 CATCCTTTGAAGGACATGGATGG + Intergenic
1074663864 10:115695821-115695843 TATCCTTTCAGGAACATGGATGG - Intronic
1075187598 10:120277033-120277055 TGTCCTTTGAAGGACATGGATGG + Intergenic
1076356984 10:129860403-129860425 TGTCCTTTGGGGAAGATGAATGG + Intronic
1076674889 10:132142612-132142634 TGCCCTCTGCGGGCCGTGGAGGG + Intronic
1078100488 11:8327717-8327739 TGTCCTCAGCGGCACTTGGATGG + Intergenic
1078420644 11:11209341-11209363 TGACCTTTGGGAGACAAGGATGG - Intergenic
1078517753 11:12039156-12039178 TGTCCTTTGCAGCACATGGATGG + Intergenic
1078864670 11:15286185-15286207 TGTGCTTTGCAGGACATGAGAGG + Intergenic
1078975287 11:16467475-16467497 TGTCCTTTGCAGGACATGGATGG + Intronic
1079295740 11:19232017-19232039 TGTCCTCTGTGGGACACGGATGG + Intronic
1081307330 11:41529538-41529560 TGTCCTTTGCATGAGATAGAAGG + Intergenic
1081462922 11:43288213-43288235 TCTCCTTTGGGGCACAAGGAAGG + Intergenic
1082179640 11:49102462-49102484 TGCCCTGTGCGGGGCCTGGAGGG - Intergenic
1082904093 11:58287185-58287207 TGTCTTTTGCAGAACATAGATGG + Intergenic
1083677794 11:64336705-64336727 TGTCCTTCGTGGGACATGGATGG - Intergenic
1083919649 11:65775433-65775455 TGTCCTTTGAAGGATATGGATGG + Intergenic
1084131825 11:67141973-67141995 TGTCATTTTCGGAACATGGATGG - Intronic
1084765800 11:71307549-71307571 AGTCCTTTACAAGACATGGAAGG - Intergenic
1085141304 11:74144754-74144776 TGTCCTTTGCAGGACATGGATGG - Intronic
1086685643 11:89730456-89730478 TGCCCTGTGCGGGGCCTGGAGGG + Intergenic
1087585311 11:100112035-100112057 TATCCTTTCCAGCACATGGAGGG + Intronic
1089144038 11:116311319-116311341 TGTCCTTTTCAGACCATGGAGGG - Intergenic
1090586941 11:128223197-128223219 TGTCCTTTGCAGGACATGGATGG - Intergenic
1091186627 11:133653370-133653392 TGTCCTCTGTGGTGCATGGATGG - Intergenic
1091348666 11:134874774-134874796 AGTCCTTGGAAGGACATGGAAGG + Intergenic
1093367455 12:18321779-18321801 TGTCTCTTGCGGGACAGAGATGG + Intronic
1097419318 12:59354369-59354391 TGTCCTTTCAGAGACATGGATGG - Intergenic
1097538359 12:60902502-60902524 TGTCATTTGCAACACATGGATGG + Intergenic
1098033545 12:66279313-66279335 TGTCCTCTGCTGGTCATGGTTGG - Intergenic
1098674567 12:73272681-73272703 TGTCCTTGCAGGAACATGGATGG + Intergenic
1099313274 12:81054247-81054269 TGTTCTTGCAGGGACATGGATGG + Intronic
1100085949 12:90911119-90911141 TGTCTTTTGAGCAACATGGATGG + Intronic
1100397560 12:94198222-94198244 TGTCCTTTTGGGGATGTGGATGG + Intronic
1101806180 12:108065981-108066003 TGTCCTTGCAGAGACATGGATGG + Intergenic
1102402192 12:112639336-112639358 TGTCCTTTGCAGGCTATGGATGG + Intronic
1102533701 12:113565612-113565634 TTTCCTTAGCGGGGAATGGAGGG + Intergenic
1102806916 12:115790120-115790142 TGTCATTTGCAGAACATGGATGG - Intergenic
1104745428 12:131207514-131207536 TGTCCTCGGCTGGACCTGGAAGG - Intergenic
1104788912 12:131469592-131469614 TGTCCTCGGCTGGACCTGGAAGG + Intergenic
1104796459 12:131523204-131523226 TATCCTTTGCAGGACATGGATGG + Intergenic
1105495782 13:20929831-20929853 TGTCTTTGCAGGGACATGGATGG - Intergenic
1105737079 13:23282633-23282655 TGCCCTTCTAGGGACATGGATGG - Intronic
1109039811 13:57317725-57317747 TGTCTTTGCAGGGACATGGATGG + Intergenic
1109986163 13:69988266-69988288 TGTCCTTGCAGGAACATGGAAGG - Intronic
1110290400 13:73799099-73799121 CGTCTTTTGCAGCACATGGATGG + Intronic
1110887791 13:80659523-80659545 TGTCTTTTGCGCAACTTGGATGG - Intergenic
1110894433 13:80731566-80731588 TGTCTTTTCAGGGACATGGATGG - Intergenic
1111882071 13:93969874-93969896 TGTCATTTGCGCAACGTGGATGG - Intronic
1113307291 13:109092420-109092442 TGTCGTTTGTGGAACATGGATGG + Intronic
1113967083 13:114159036-114159058 TGTCTTTGCAGGGACATGGATGG - Intergenic
1114829139 14:26118231-26118253 TGTCCTTTGCAGGACATGGATGG + Intergenic
1115764714 14:36611837-36611859 TGTTTTTTGCAGGACATGGATGG + Intergenic
1116035544 14:39622798-39622820 TGTCCTTGGCAGGACATGGATGG - Intergenic
1116286802 14:42984966-42984988 TGTCATTTGAGGGACCTGGTGGG - Intergenic
1116642010 14:47475664-47475686 TATCCTTTCAGGGACATAGATGG + Intronic
1116943687 14:50816036-50816058 TGTCCTTTGCAAGACATAGATGG + Intronic
1117842462 14:59873976-59873998 TGTCATTTGCACAACATGGATGG - Intergenic
1118816869 14:69320088-69320110 TGTTCTTTGCGGGATATTGGGGG - Intronic
1119583492 14:75809869-75809891 TGTCATTTGCAGAACATAGATGG - Intronic
1119584819 14:75823403-75823425 TTTTCTTTGTGAGACATGGAAGG + Intronic
1120058955 14:79959374-79959396 TGTCCTTTGAGGGACATGGATGG + Intergenic
1122198320 14:100106577-100106599 TCTCCTTTGCAGTACATGTAAGG + Intronic
1127407727 15:58669316-58669338 TGACCTTTGAGAGGCATGGAAGG - Intronic
1128470556 15:67948381-67948403 TGTCTTTGCAGGGACATGGATGG - Intergenic
1128901812 15:71429584-71429606 TTTCCTTTGGGAGAGATGGAGGG + Intronic
1130181045 15:81628909-81628931 TGTCCTTTGCAGGGCGCGGATGG + Intergenic
1130207107 15:81887348-81887370 TGTCTTTAGAGGAACATGGATGG - Intergenic
1131419519 15:92293013-92293035 TGTCCTTCTGGGGTCATGGATGG + Intergenic
1132245293 15:100291679-100291701 TGTCCTCTGCAGCACATGGATGG + Intronic
1132248813 15:100318045-100318067 GGACATTTGCAGGACATGGAAGG + Intronic
1137811424 16:51356487-51356509 TGGCCTCTGCGTGACATGGAGGG - Intergenic
1140256915 16:73345542-73345564 TGTCCTCGCAGGGACATGGATGG - Intergenic
1143025094 17:3936875-3936897 TGTGTGTTGCTGGACATGGATGG - Intronic
1145939650 17:28736077-28736099 TGTCCTTTGTAGGACATGGATGG - Intronic
1148026270 17:44589858-44589880 TGTCTTCTGCGGGAGATGGCGGG - Intergenic
1150527990 17:65944048-65944070 TGTCTTTGCAGGGACATGGATGG + Intronic
1151574509 17:74945610-74945632 TGTGCTCTGAGGGACAGGGATGG + Intronic
1151973777 17:77472474-77472496 GCTCCTTTGCAGGACCTGGAAGG - Intronic
1152941838 17:83176945-83176967 GCTCCTGTGCGGGACATTGATGG - Intergenic
1153474841 18:5488260-5488282 TGTCCTTTTCAGGACATGGATGG + Intronic
1153837250 18:8974975-8974997 TGTCATTTGCAAAACATGGATGG + Intergenic
1153842481 18:9019275-9019297 TGTCTTTTTGGGAACATGGATGG - Intergenic
1154302811 18:13209246-13209268 TGTCCTTTGCAGGATGTGGATGG - Intergenic
1156437494 18:37148279-37148301 TGTCCTTTCAGGGACACAGATGG - Intronic
1156715364 18:40002561-40002583 TGTATTTTGCAGAACATGGATGG + Intergenic
1157084319 18:44563485-44563507 TGTCCTTTGAGGAACCTGGTTGG + Intergenic
1157182098 18:45507019-45507041 TGTCCTTTCCTGTACATTGAAGG + Intronic
1158124770 18:54088900-54088922 TGGCTCTTGCGGGACTTGGATGG - Intergenic
1159153362 18:64549867-64549889 TGTCCATTGCGGGAAGTGGGTGG + Intergenic
1159277451 18:66239170-66239192 TGTCTTTGTCGGAACATGGATGG + Intergenic
1160081765 18:75734559-75734581 TGTCCTTTGCAGGACATGGATGG - Intergenic
1160177691 18:76609242-76609264 TGTGCTTTGGGGGCCATGGTTGG - Intergenic
1161846875 19:6716770-6716792 TCTCATTTGCAGGACATGGCAGG + Intronic
1164929168 19:32161266-32161288 TGTCTTTGCAGGGACATGGATGG + Intergenic
1165521976 19:36321767-36321789 TGTCCTTTGGGGGACACAGTGGG + Intergenic
1165574373 19:36801444-36801466 TGTCCTTTGGGGGACACAGTGGG - Intergenic
1165633835 19:37323776-37323798 TGTCCTTTGGGGGACACAGTGGG - Intronic
925597698 2:5572362-5572384 AGTCCTTTTCTGGACAAGGAAGG + Intergenic
926758925 2:16260196-16260218 TGTCCTTGGAGGAACATGGCTGG + Intergenic
928258685 2:29747587-29747609 GGTCCTGTGCTGGACATTGAGGG - Intronic
928634146 2:33225884-33225906 TGTCATTTGTGTAACATGGATGG - Intronic
929629521 2:43445187-43445209 TTTCCTTTGCGGGGGATGGGGGG - Intronic
930191593 2:48465723-48465745 TGTCCTTTGCAGTACTTGGATGG - Intronic
930446108 2:51474394-51474416 TGGACTTTGGGGGACTTGGAGGG + Intergenic
931285162 2:60825859-60825881 TGTCATTTGAGGGGGATGGAGGG - Intergenic
931502148 2:62881080-62881102 TGTTCTTTGCAGCACATGGATGG + Intronic
931531605 2:63221005-63221027 TGTCCTTTGAGGGACAGGGATGG - Intronic
931779762 2:65568808-65568830 TGGCCTTTGCAGCACATGGGTGG - Intergenic
931798415 2:65734362-65734384 TTTTTTTTGCAGGACATGGATGG - Intergenic
931858734 2:66331588-66331610 TTTCCTTTTCGGTATATGGAAGG - Intergenic
932647463 2:73518268-73518290 TGTCTTTTGCAGAACATGGATGG - Intronic
932977293 2:76618693-76618715 TGTCATTTGCAGTACATGGGTGG - Intergenic
933196614 2:79397372-79397394 TGTCCTTGGCTGGAAAAGGAAGG - Intronic
933258487 2:80106888-80106910 TGTCCTTTGGGGGCCCTGGCAGG + Intronic
937050642 2:118885700-118885722 TGTCCTTTGAGGGACAAAGTTGG - Intergenic
937442971 2:121932604-121932626 TGTCTTGTGCGTGCCATGGAGGG + Intergenic
937464304 2:122116921-122116943 TGTCATTTTCAGCACATGGATGG - Intergenic
937678830 2:124622272-124622294 TGTCTTTGCAGGGACATGGATGG - Intronic
937735966 2:125289750-125289772 TGTCCTTTGCGGGACATGGATGG - Intergenic
937946085 2:127338635-127338657 TGTCCTTTCAGGAACATGGATGG - Intronic
939700911 2:145389261-145389283 TGTCCTTGAAGGGACATGAATGG - Intergenic
940898631 2:159105585-159105607 TGTCTTTTGCGGGGTATAGAGGG - Intronic
945377472 2:209096304-209096326 TGCTCTTTGCAGAACATGGATGG - Intergenic
947393144 2:229660424-229660446 TGTCCTTGCAGGGACATGGATGG - Intronic
1169604137 20:7296286-7296308 TGTCTTTGCAGGGACATGGATGG - Intergenic
1170282260 20:14663170-14663192 TGTTCTTTGTAGGACAGGGATGG + Intronic
1171110722 20:22479593-22479615 ATTCCTTTCAGGGACATGGATGG + Intergenic
1173229890 20:41185870-41185892 TGTCCTTTGTGGGACAGAGCAGG - Intronic
1174431739 20:50475113-50475135 TGTCCTCTGCAGGGCATGGCAGG + Intergenic
1177218562 21:18160637-18160659 TGTCCTTGCAGGGACATGGATGG - Intronic
1180797368 22:18612599-18612621 TGGCTTTTGGGAGACATGGATGG + Intergenic
1181829921 22:25552053-25552075 TGTCTTTGCAGGGACATGGATGG - Intergenic
1182519162 22:30875705-30875727 TGTACTTTGTGGGCCTTGGAAGG + Intronic
1183492367 22:38123388-38123410 TGTCCTATGCAGGACAGCGAGGG + Intronic
1184854375 22:47138403-47138425 TGGCCTCTGGGGGACAGGGAGGG + Intronic
951761602 3:26153225-26153247 AGTCCTTGGTGGGACATGGGAGG + Intergenic
952888669 3:38027037-38027059 TGTCCTTTGGGGCACATCGGGGG + Intronic
953816016 3:46157387-46157409 TGTCCTTTGCAAGGAATGGATGG - Intergenic
955125694 3:56109324-56109346 TGTCTTTTGTGGAACATGGATGG - Intronic
956687811 3:71847400-71847422 TATCATTTGCAGGAGATGGAGGG - Intergenic
957482732 3:80819356-80819378 TGTCCTTTGTGCAACATGGATGG + Intergenic
959495268 3:107043016-107043038 TGTCTTTTCAGAGACATGGATGG + Intergenic
959773740 3:110132074-110132096 TGTCCTTTGCAGGACATAGATGG + Intergenic
960227180 3:115182327-115182349 TGTCCTTTCAGCAACATGGATGG + Intergenic
961058758 3:123810782-123810804 TGTCCTTTGGGAGACAGGCAGGG - Intronic
962089391 3:132227327-132227349 TGTCCTTTGCAGGGAATGGAGGG - Intronic
963532545 3:146489006-146489028 TGTCCTTTGCAGGACATGGATGG + Intronic
963747381 3:149138513-149138535 TGTAATTTGGAGGACATGGATGG + Intronic
965993851 3:174854218-174854240 TATCTTTTGCAGTACATGGATGG + Intronic
966654800 3:182343833-182343855 TGTTCTTTGCAGCACATGGATGG - Intergenic
967787605 3:193514384-193514406 TGTCCTTTTCAGGACATGGATGG - Intronic
968907732 4:3462452-3462474 TGTGCTTTGGGGGACCTGGCAGG - Intergenic
969082570 4:4630667-4630689 TGTCCCCTGCAGGACATGGATGG + Intergenic
970146085 4:13037576-13037598 TTTCTTTGGAGGGACATGGATGG + Intergenic
970836104 4:20409373-20409395 TGTCCTTTTAGGGACATGGATGG - Intronic
971620199 4:28845786-28845808 TGTTCTTTGCAGGACATGGATGG - Intergenic
972310338 4:37876277-37876299 AGTCCTATGTGTGACATGGAAGG - Intergenic
972910663 4:43812649-43812671 TGTCCTTTGCAGAGCGTGGATGG + Intergenic
972984854 4:44750733-44750755 TGTCCTTTCCGGGACATGGATGG - Intergenic
974454227 4:62105418-62105440 TGTCTTTGCAGGGACATGGATGG - Intergenic
974761351 4:66278350-66278372 TGTCTTTGCAGGGACATGGATGG - Intergenic
975398816 4:73910098-73910120 TGTCCTTGTAGGGACATGGATGG + Intergenic
975889090 4:79003447-79003469 TGTCCTTTCAGGGACATGGATGG + Intergenic
975978096 4:80122017-80122039 TGTTCTTGCAGGGACATGGATGG + Intronic
976793270 4:88904456-88904478 TGTCCTTTCTAGGACATGGATGG + Intronic
977520153 4:98072248-98072270 TGTCCTTTGCGGGACATGAATGG + Intronic
979141186 4:117176726-117176748 TGTCCTCTGATGAACATGGATGG - Intergenic
980282758 4:130741797-130741819 TATCCTTTGGAGAACATGGATGG - Intergenic
980857486 4:138456601-138456623 TGTGCTGTGCAGGACATGGATGG + Intergenic
981078314 4:140613504-140613526 TGTCTTTGCAGGGACATGGATGG + Intergenic
982803797 4:159737403-159737425 TGTTCTTTGTGGAACATTGATGG + Intergenic
983155620 4:164344063-164344085 TGTCCTTTGCACAGCATGGATGG + Intronic
983419459 4:167499643-167499665 TTTTTTTTGCAGGACATGGATGG - Intergenic
983462341 4:168043008-168043030 TGTACTTTGCAGCACTTGGATGG + Intergenic
983584319 4:169339157-169339179 TGTCCTTGCAGGGGCATGGATGG - Intergenic
984628016 4:182030384-182030406 TGTCTTTTGCAGGACAGGGATGG - Intergenic
986706049 5:10455603-10455625 TATCCTGTGCAGGACAGGGATGG - Intronic
989962678 5:50435250-50435272 TGTCCTTTGTAGGAAATAGACGG - Intronic
991680858 5:69137971-69137993 TATCCTTTGAGCAACATGGATGG - Intergenic
993071139 5:83165787-83165809 TGTCCTTTGCAGGACATGGATGG - Intronic
993247684 5:85471655-85471677 TGTCCTTTGCAAAACATGGATGG + Intergenic
993568689 5:89508562-89508584 TGTCTTTTGCGGAACATGGATGG + Intergenic
993795118 5:92257490-92257512 TGTCCTTTGCAGCATACGGATGG + Intergenic
993820605 5:92611011-92611033 TATCCTTTGCAGGACATGGATGG + Intergenic
993889903 5:93461172-93461194 TGTCCTTTGCAAGACATGGATGG + Intergenic
994543291 5:101128142-101128164 CGTCCTTTGCAGGGCATGGATGG + Intergenic
995059044 5:107794179-107794201 TGTCCTTTGCAAAACATGGATGG + Intergenic
995357641 5:111257835-111257857 TGTCCTTCGCAGGACATGGATGG + Intronic
995621904 5:114034868-114034890 TGTTCTTTGCAGAACATGGATGG - Intergenic
997754535 5:136383696-136383718 CATCCTTTCAGGGACATGGATGG - Intronic
997785989 5:136714456-136714478 TGTCCTTTGCAGAAAATGGATGG - Intergenic
998046909 5:138995012-138995034 TGTCCTTTGCAGGACATGAATGG - Intronic
998604717 5:143621948-143621970 TGTCTTTTGCAGAACATGGATGG + Intergenic
999939221 5:156522423-156522445 TGCCCTTTTCAGGACATAGATGG + Intronic
1000189600 5:158897255-158897277 TGTCCTTTGCGGGACATGGATGG + Intronic
1000474085 5:161683760-161683782 TGTCTTTGCAGGGACATGGATGG + Intronic
1000588463 5:163129143-163129165 TGTCCTTTGCAGAACATGGATGG + Intergenic
1000668121 5:164024329-164024351 TGTCCTTTGCAGGAACTGGATGG - Intergenic
1001178895 5:169499782-169499804 TGTCCTTTGTGCAACATGGATGG - Intergenic
1001448862 5:171808654-171808676 TGTCCTTTGCAGAACGTGGATGG + Intergenic
1001483821 5:172105817-172105839 TGTCCTTTGAGGGGCATGATTGG - Intronic
1002069790 5:176672338-176672360 TGTCCTCTGCAGGACCTGCAGGG - Intergenic
1002967748 6:1984058-1984080 TGTCCTTTGTGGGACATGGATGG + Intronic
1003740886 6:8937684-8937706 TGTCCTTGCAGGGACATGGATGG - Intergenic
1005919240 6:30384100-30384122 TGTCCTTTGCGGAACATGGATGG - Intergenic
1008208558 6:48692786-48692808 TGTCCTTTGCAGGACATAGATGG + Intergenic
1010520049 6:76821510-76821532 TGTCTTTGCAGGGACATGGATGG - Intergenic
1010802081 6:80188165-80188187 TGTCCTTTGCAGGACATATCTGG + Intronic
1010900413 6:81421654-81421676 TGTCCTTGGAGGGACCTGGTGGG + Intergenic
1012784110 6:103601307-103601329 TGTCTTTGCAGGGACATGGATGG - Intergenic
1013508628 6:110824260-110824282 TGTCTTTTGAGGAACTTGGATGG + Intronic
1013896723 6:115097553-115097575 TGTCCTCTGCAGGACGTGAACGG - Intergenic
1014012775 6:116495317-116495339 TGTCATTTGCAAAACATGGATGG - Intronic
1014324610 6:119976943-119976965 TGACCTTTGAGGGAAATGAATGG + Intergenic
1014375300 6:120664774-120664796 TGTCCTTTGCAGGGCATGGATGG - Intergenic
1016633835 6:146264838-146264860 TGTCTTTTGTGCAACATGGATGG - Intronic
1018573969 6:165238596-165238618 TGTCCTTTGTGCAGCATGGATGG - Intergenic
1019098427 6:169607465-169607487 TGTCTTTTGCAGCACATGGATGG + Intronic
1019325292 7:435267-435289 TGTCTTCTGTGTGACATGGAGGG - Intergenic
1020706393 7:11549617-11549639 TGTCTTTGAAGGGACATGGATGG + Intronic
1021199500 7:17712350-17712372 TGCCCTTTGCGGGACATAGATGG + Intergenic
1021364247 7:19756750-19756772 GGTCTTTTGCAGGACATGGATGG - Intronic
1026604713 7:71805926-71805948 TGTCCTTGCAGGGACATAGATGG + Intronic
1028170354 7:87588484-87588506 CGTCCTTTGCAGGGCATGGCTGG - Intronic
1029160710 7:98549438-98549460 TGTCCATTGCAGGAGATGCAGGG - Intergenic
1030058973 7:105608005-105608027 TGCCCTTTGCTGGATATGGGAGG - Intronic
1031247014 7:119326620-119326642 TTTCTTTTCAGGGACATGGATGG + Intergenic
1032081547 7:128861002-128861024 TGGCCTGTGCAGCACATGGATGG - Intergenic
1033737207 7:144234309-144234331 TATCCTTTGATGGACATGGATGG + Intergenic
1033745850 7:144316637-144316659 TGTCCTTTGATGGACATGGATGG - Intergenic
1034937880 7:155211437-155211459 TGGCCTTTGCAGGTCATGGTGGG - Intergenic
1035414200 7:158669072-158669094 TGTTCTTTGCAGGGAATGGATGG - Intronic
1039378517 8:37061834-37061856 TGACCATTGCGGGACATGTATGG - Intergenic
1041572043 8:59348747-59348769 TGTCCTTTGCAGAACATGGATGG + Intergenic
1043001536 8:74766019-74766041 TGTCCTTTGCAGGAACAGGATGG + Intronic
1043325044 8:79039759-79039781 TGTCATTTGCAGGACATGATTGG + Intergenic
1043716955 8:83498848-83498870 TGTCCTGGGAGGGACATGGTAGG + Intergenic
1044928478 8:97229696-97229718 TGTCCTTTCAGCAACATGGATGG + Intergenic
1046418965 8:113954180-113954202 TGTCCTTAGCTGGAGATGTAAGG + Intergenic
1047650253 8:126912805-126912827 TGTCCTGTGAGGGACCTGGTGGG + Intergenic
1048109350 8:131450838-131450860 TGTCTTTTGCAGGACATGGATGG - Intergenic
1048325616 8:133436817-133436839 TGTCCTTTGTTGGACTTTGAAGG - Intergenic
1049086035 8:140479313-140479335 TGTCTTTTCAGGGACATGGATGG + Intergenic
1050506818 9:6357299-6357321 TGTACTTTAGGAGACATGGAGGG - Intergenic
1050624027 9:7484718-7484740 TGTCTTTGCAGGGACATGGATGG + Intergenic
1050804030 9:9651545-9651567 TGTCCTTTGCAGGACATGGATGG - Intronic
1052618782 9:30878104-30878126 TGTCCTTTGCAGAACATGGATGG - Intergenic
1054144748 9:61554180-61554202 TGGCCTTTTGGGGTCATGGAGGG - Intergenic
1056485337 9:87051301-87051323 TGTCTTTTGCAGAGCATGGATGG + Intergenic
1056567871 9:87790773-87790795 TGTCATTTGCGTGAAATGGATGG + Intergenic
1056844702 9:90027133-90027155 TGTGATTTGCAGGACATAGAAGG - Intergenic
1057980406 9:99655852-99655874 TGTCATTTGTGCAACATGGATGG + Intergenic
1058234177 9:102468524-102468546 TGTCCTTTGAGGGACGTGGACGG + Intergenic
1058406463 9:104681056-104681078 TGTCATTTGCACAACATGGATGG + Intergenic
1058549369 9:106097549-106097571 TGTCCTTTGCAGGACATGGATGG + Intergenic
1059003349 9:110374292-110374314 TGTTCTTTGTGGAATATGGATGG - Intronic
1059831700 9:118103394-118103416 TGTCCTTTGCAGGGCATGGGTGG + Intergenic
1060446370 9:123691990-123692012 TGTCCATTGTGAGACATGGCAGG + Intronic
1060846343 9:126840488-126840510 TGTCCTTTGAGGGACTTTGTGGG + Intergenic
1185732181 X:2470084-2470106 TGCCATTTGCGCAACATGGATGG + Intronic
1186051300 X:5598504-5598526 CGTCTTTTGCAGAACATGGATGG - Intergenic
1186115694 X:6303181-6303203 TGTCTTTTCAGGGACATGGATGG - Intergenic
1187640241 X:21279763-21279785 TGTCTTTTGCAGGACATGAATGG - Intergenic
1187640561 X:21284263-21284285 TGTCCTTGGCAGGACGTGGATGG + Intergenic
1187724560 X:22189082-22189104 TGTCATTTGCAACACATGGATGG - Intronic
1188090620 X:25960196-25960218 TTTCTTTTGCAGGGCATGGATGG - Intergenic
1189609893 X:42721051-42721073 TGTCTTTGTAGGGACATGGATGG - Intergenic
1189926742 X:45962709-45962731 TGTACTTTGCAGCACATGCATGG + Intergenic
1190373915 X:49769975-49769997 TGTCCTTTGTGGGATATGGATGG - Intergenic
1191026762 X:55922302-55922324 TGTCCTTTGTAGGACATGGATGG + Intergenic
1191922855 X:66275925-66275947 TGTCTTCTGGGGAACATGGATGG + Intergenic
1191991032 X:67037251-67037273 TGTCCTTTGTGGAACTTGGATGG + Intergenic
1193739531 X:85201768-85201790 TTTCTTTTGTGGAACATGGATGG - Intergenic
1193857061 X:86616074-86616096 TGTGTTTTGGGGAACATGGATGG - Intronic
1193877172 X:86874399-86874421 TGTCCTGTGCAGGACACAGATGG + Intergenic
1194172585 X:90605807-90605829 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1195207668 X:102619246-102619268 TGTCCTTTGCAGCAAATTGATGG - Intergenic
1195213602 X:102674448-102674470 TGTCCTTTCAGGGACATGGATGG - Intergenic
1196486568 X:116217303-116217325 TGTCTTTTGCAGAACATGGATGG + Intergenic
1198998341 X:142602866-142602888 TGTCCTTTGCAGAACATGGATGG - Intergenic
1200518812 Y:4183544-4183566 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1201537193 Y:15063406-15063428 TGTAGCTTGCAGGACATGGATGG - Intergenic
1202275668 Y:23117094-23117116 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202290360 Y:23303597-23303619 TGTCTTTTGCAGGAAGTGGATGG - Intergenic
1202428660 Y:24750813-24750835 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202442131 Y:24919276-24919298 TGTCTTTTGCAGGAAGTGGATGG - Intergenic