ID: 1000197306

View in Genome Browser
Species Human (GRCh38)
Location 5:158972182-158972204
Sequence CTGGGGACACAGATTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 279}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000197306_1000197316 18 Left 1000197306 5:158972182-158972204 CCCACCTCAATCTGTGTCCCCAG 0: 1
1: 0
2: 3
3: 24
4: 279
Right 1000197316 5:158972223-158972245 TGCTCTTCCATCTACCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000197306 Original CRISPR CTGGGGACACAGATTGAGGT GGG (reversed) Intronic
900095019 1:936697-936719 TGGGGGACACAGATGGGGGTGGG - Intronic
901325911 1:8364976-8364998 CTGGGTGCACAGGCTGAGGTAGG + Intronic
901465759 1:9419990-9420012 CTGAGGACTCAGCCTGAGGTAGG + Intergenic
904254183 1:29244092-29244114 CTGGGGAGAAAGATTGAGATGGG + Intronic
905304118 1:37005851-37005873 CTGGGGACACAGAGGTAGATGGG + Intronic
907265467 1:53257299-53257321 CTGGGGACACTAACTGAGCTTGG + Exonic
908234610 1:62137604-62137626 GGGGGGACACAGAGTGAGGGGGG + Intronic
908339421 1:63161306-63161328 GTGGGGAGACAGATTGGGGCTGG + Intergenic
908581711 1:65524259-65524281 ATGGAGACAAAAATTGAGGTAGG - Intronic
910023461 1:82621486-82621508 TTGGGGCCACAGAGTGGGGTTGG + Intergenic
910053609 1:83005747-83005769 CTGGAGATGCTGATTGAGGTTGG + Intergenic
910273642 1:85424215-85424237 CTGGCCACACAGAATGAGTTAGG + Intronic
913175774 1:116271837-116271859 CTGACAACTCAGATTGAGGTTGG + Intergenic
913194472 1:116444365-116444387 TTGGGGACATAGTTTGACGTGGG + Intergenic
913462965 1:119108189-119108211 CTGGGTTCACAGAATGAGTTTGG + Intronic
913552212 1:119926574-119926596 CTGGGGACACACATCGACGAAGG + Exonic
916362461 1:163985678-163985700 GTGGGAACATAGATTAAGGTGGG + Intergenic
916429544 1:164713690-164713712 AGGGGCACACAGATTGAAGTAGG + Intronic
916920129 1:169457018-169457040 CTGGGTACACAATTTTAGGTAGG + Intronic
917207307 1:172590775-172590797 CTTGGGATGCAGATGGAGGTAGG - Intronic
918843563 1:189578289-189578311 CTGGGCACAAAAATTGATGTAGG - Intergenic
921681623 1:218039818-218039840 CTTAGGAATCAGATTGAGGTGGG + Intergenic
922319427 1:224472630-224472652 CTGGGGAAAAGGATTGAGGATGG + Intronic
922869024 1:228884955-228884977 CCTGGGGCACAGATTGAGGCAGG - Intergenic
924445622 1:244127784-244127806 CTGGGGATACAGAGGAAGGTGGG - Intergenic
1063477236 10:6339961-6339983 CTGGGGACAGAGTTTCAGTTTGG + Intergenic
1063499515 10:6540350-6540372 ATGGGGACAGAGTTTGAGTTTGG - Intronic
1063856016 10:10254943-10254965 CTGGGGACCCAGCTTTAGGGAGG + Intergenic
1064506852 10:16040573-16040595 CTGGGGAAACAGAATTAGCTCGG + Intergenic
1064518735 10:16178011-16178033 CAGGGGAGAAAGATCGAGGTTGG + Intergenic
1065890775 10:30119289-30119311 CTGGAGACACTAACTGAGGTTGG - Intergenic
1066269981 10:33812952-33812974 CTGGGGACACTGCTTGTGGCTGG - Intergenic
1066277985 10:33887529-33887551 CTAGAGACCCAGACTGAGGTTGG - Intergenic
1066654603 10:37686503-37686525 CTGGGGAGATAGAGTGAGGGAGG + Intergenic
1067192295 10:44081804-44081826 CTGTGGACACAGGTTCAAGTTGG + Intergenic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1070680784 10:78447729-78447751 CTGGGGATGCTAATTGAGGTTGG - Intergenic
1071782070 10:88856887-88856909 CTGAGGGAACAGAGTGAGGTTGG - Intergenic
1072434673 10:95404179-95404201 CTGGGGCCAGAGAATGAGGTGGG + Intronic
1072829611 10:98644067-98644089 CATGGGCCACAGATTGGGGTAGG - Intronic
1073423615 10:103443052-103443074 CTGAGGACACAGATAGAGGCTGG + Intronic
1073560903 10:104496037-104496059 CTGGGGCCACATATGGAGGGAGG - Intergenic
1075267476 10:121015241-121015263 CTGGGCTCACAGAATGAGTTAGG - Intergenic
1075362878 10:121855204-121855226 GTGTGGACACAGAGTGAGATTGG - Intronic
1075419963 10:122293449-122293471 CAGGGGACACACATTGAAGAGGG + Intronic
1075615131 10:123885201-123885223 CTGGGGACTCAGGGTGGGGTTGG + Intronic
1075643483 10:124082210-124082232 CTGGGGCAGCAGATTAAGGTGGG - Intronic
1076764872 10:132627541-132627563 CTGGGGACACAGAGGGAGTCGGG - Intronic
1079122445 11:17695701-17695723 CTGAGGACAGAGATGGAGGCCGG + Intergenic
1080005898 11:27406076-27406098 ATGGGGACACAGACTGGGATAGG - Intronic
1081854261 11:46294248-46294270 CTGGGGGCTGAGAGTGAGGTCGG + Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1087277647 11:96176446-96176468 CAGGGGACTCATCTTGAGGTAGG + Intronic
1087657975 11:100949250-100949272 CTGGTAACACAGTTTGAGGGAGG - Intronic
1089361483 11:117890846-117890868 CTGGGAACAGAGGCTGAGGTTGG - Intergenic
1090412002 11:126515705-126515727 CTGGGGACACAGCTGGGGGCTGG + Intronic
1092749018 12:11701248-11701270 CTGGGGACAGAGTTTCAGCTGGG - Intronic
1093894424 12:24561609-24561631 CTTGGTACACTGAGTGAGGTGGG + Intergenic
1095734064 12:45537033-45537055 CTGGGTACACAGATAGTGCTCGG - Intergenic
1096480713 12:51939045-51939067 CTGGTTACACAGAATGAGTTGGG - Intergenic
1096542490 12:52315810-52315832 CTGGGGACTGAGACTGAGATAGG + Intronic
1096604104 12:52752741-52752763 CTCAGGACACAGATGGAGCTGGG - Intergenic
1096869066 12:54582132-54582154 CTGGGGACACAGAGAAAGGGAGG + Intronic
1100765947 12:97865820-97865842 CTGGGGGGATAGATTGAGGAGGG - Intergenic
1102781265 12:115567086-115567108 TTGGGGAGAAAGAGTGAGGTGGG - Intergenic
1105345475 13:19567324-19567346 CTGGGGAAACAGGTTGATGGAGG + Intergenic
1105797074 13:23865969-23865991 CTGGGGACACTAATTGAGGCAGG - Intronic
1105816485 13:24040839-24040861 TTGAGGATACAGATTGTGGTTGG + Intronic
1106314166 13:28578778-28578800 CTTGGTACCCAGATTGGGGTGGG + Intergenic
1107013318 13:35689314-35689336 GTGCCCACACAGATTGAGGTTGG - Intergenic
1107555437 13:41513480-41513502 CTGAGGACACAGCATGAGGACGG + Intergenic
1108499942 13:51060675-51060697 GTGGGGACACAAATCCAGGTCGG - Intergenic
1110879961 13:80559407-80559429 CTTGGGACAGAGATTGAGCCTGG + Intergenic
1111908942 13:94288417-94288439 CTGGGGACATGGAGGGAGGTGGG - Intronic
1112655638 13:101449951-101449973 CTGGGGACACAGCAGTAGGTTGG - Intergenic
1113972450 13:114200302-114200324 CTGGGGACAGAGAAGGAGGCTGG - Intergenic
1117313472 14:54551267-54551289 CTGGGGAAACAAAGTGAAGTTGG - Intergenic
1117943375 14:60992619-60992641 CTGGGGACTGAGTGTGAGGTGGG + Intronic
1122005110 14:98697015-98697037 CTGGGGCCACAGGTGGGGGTGGG + Intergenic
1123029539 14:105445179-105445201 ATGGAGACACAGGTTGAGGTTGG + Intronic
1123991091 15:25683882-25683904 CTGGGGTCACAGACAGAGGAGGG - Intronic
1126219914 15:46200954-46200976 GTGGGAACACAGATTGATGCGGG - Intergenic
1126589312 15:50323465-50323487 CTGAGGACCCAGAGTGAGGCAGG + Intronic
1128318689 15:66677879-66677901 CAGGGGACACATTTGGAGGTTGG + Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1130306517 15:82715314-82715336 CTGGGGGCTCAGATTCAAGTGGG - Intergenic
1130366693 15:83247094-83247116 CTGGTGTCACAGAATGAGTTAGG + Intergenic
1131652179 15:94412062-94412084 ATGGAGCCACAGAATGAGGTAGG + Intronic
1131945302 15:97613591-97613613 CTGGAGACATAGAATGAGTTTGG - Intergenic
1132720538 16:1313601-1313623 CTGGGGCCCCAGATGGATGTGGG - Intronic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1133059473 16:3165109-3165131 ATGGGGACACAGATTGAGTTGGG - Intergenic
1133547154 16:6818709-6818731 CTGATGACACAGACTGAGGGTGG - Intronic
1133970205 16:10562056-10562078 CTGGCCTCACAGAATGAGGTGGG - Intronic
1134384704 16:13760773-13760795 CTGAGCACATAGAATGAGGTGGG - Intergenic
1135898462 16:26432274-26432296 CTGGAGAGAGAGATTGAGATCGG - Intergenic
1136279487 16:29199640-29199662 GTGGGGACACAGTTTCAGTTTGG - Intergenic
1137836446 16:51597028-51597050 CTGGGGACAATGTTGGAGGTGGG + Intergenic
1138326694 16:56178080-56178102 CTGGTGACATAGATTAAGTTGGG + Intergenic
1138341265 16:56290521-56290543 CTGGAGACCCAGAATGAGTTTGG + Intronic
1138387339 16:56644621-56644643 CTGGAGGCACAGCTTGAGGCAGG + Intronic
1139259888 16:65581219-65581241 CTGTAGATACACATTGAGGTTGG + Intergenic
1139526807 16:67521721-67521743 CTGGGGACACCGCCTGAGGCTGG - Intronic
1140055987 16:71526210-71526232 GTGGGGAGACTGCTTGAGGTGGG - Exonic
1141149874 16:81556622-81556644 ATGGGGACAGAGTTTGAGTTTGG + Intronic
1141286379 16:82676329-82676351 ATGGTGCCACAGAATGAGGTAGG - Intronic
1141660369 16:85438097-85438119 CGGGGGACACAGAGAAAGGTAGG - Intergenic
1141780679 16:86158439-86158461 CTGGGGACACAGCATGAGGATGG + Intergenic
1141979667 16:87542101-87542123 CTGGGGACACAGGTTGGGGGTGG + Intergenic
1142676820 17:1518574-1518596 CTGGGGCAACAGGTGGAGGTGGG + Exonic
1143141110 17:4742308-4742330 CTGGGGACACAGCGGGTGGTGGG - Intronic
1145984919 17:29039208-29039230 GTGGGGACAGAGATAGAGGAGGG - Intronic
1146793817 17:35767609-35767631 CTGGGGTCACAGGTTCAGATTGG + Intronic
1146938735 17:36828709-36828731 CTTGGGGCACAGACTTAGGTGGG - Intergenic
1147443445 17:40461217-40461239 CTGAAGACAGAGGTTGAGGTTGG + Intergenic
1147631994 17:41938241-41938263 CTGAGGACACAGCTTGAACTGGG + Intronic
1148793206 17:50185080-50185102 CTGGGGAGACAGATTTGGGAAGG + Exonic
1148805037 17:50259700-50259722 CTGGGGCCACAGAGTGGGGAGGG - Intergenic
1149535702 17:57431817-57431839 CTGGGGGCAGAGAGTGAAGTGGG - Intronic
1149921512 17:60664911-60664933 CTGGGGAGAGAGATTGAGGCAGG - Exonic
1150773575 17:68061672-68061694 CTCCGGACACAGAATGAGGCTGG + Intergenic
1151478012 17:74354678-74354700 CTGGGGACAGAGACTGTGGAGGG - Intronic
1151560391 17:74866636-74866658 CTGGGGACACAGAGTGGTGAGGG - Intronic
1152073152 17:78143985-78144007 CTGGGGACACAGTATGGGGGAGG + Intergenic
1153166020 18:2263023-2263045 CTGGGTACAGAGACTGAGGTGGG + Intergenic
1153236180 18:2990823-2990845 CGGGGAACAGAGATTGAAGTAGG - Intronic
1155531618 18:26772576-26772598 GTGGGGACAAAGAATAAGGTTGG + Intergenic
1156610596 18:38719347-38719369 CTAAGGACATAGAGTGAGGTGGG + Intergenic
1157295010 18:46435931-46435953 CTGGGGAGAGAGGTTGAGGGTGG + Intronic
1157585672 18:48799696-48799718 CTGGGTGCACAGAGAGAGGTGGG - Intronic
1158432338 18:57400703-57400725 CTGGGGACACAGAATCATATAGG - Intergenic
1160807362 19:998267-998289 CTGGGGACAGAGTTTCAGTTTGG + Intronic
1162133037 19:8538877-8538899 CTGGGGACACAGTTTCAGTTTGG + Intronic
1162931234 19:13958979-13959001 CTGGGGACACTGAGCGAGGCTGG + Intronic
1164131556 19:22367446-22367468 CTGGGCACACAGCTAGAGGAAGG + Intergenic
1164609698 19:29623811-29623833 CTGGGGCCACAGGGTGCGGTGGG + Intergenic
1164943842 19:32273349-32273371 CTGGAGATACAGATTAACGTTGG - Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165951631 19:39476806-39476828 ATGGGAAAACAGATTTAGGTAGG - Intergenic
1166147076 19:40845234-40845256 CTGGGGACACAGAGAGGGGCTGG + Intronic
1166179072 19:41094477-41094499 CTGGGGACACAGAGAGAGGCTGG - Intronic
1166552526 19:43675777-43675799 CTGGGGATAGAGATGGAGGTGGG + Intergenic
1166965229 19:46525879-46525901 CTGGACACACAGATTGAGAGAGG + Intronic
1167473752 19:49688883-49688905 CTGGGGACACTGAGTGGGTTGGG + Exonic
1167826685 19:51979673-51979695 CTGGGTCCACAGAGTGGGGTAGG - Intronic
927399013 2:22689298-22689320 TTGGGGACACAGAATGGAGTAGG - Intergenic
929106760 2:38372905-38372927 CTGTGGACAGAGATTTAGTTTGG - Intronic
929664281 2:43821774-43821796 CTGGGGAGAGAGATTGAAATTGG - Intronic
931935117 2:67188082-67188104 CTGGGGACAAAGCCTGAGCTTGG + Intergenic
934059721 2:88282998-88283020 CAGAGCACACAGAATGAGGTGGG - Intergenic
934683847 2:96306067-96306089 TTGGGGGCACAGGTTTAGGTGGG - Intergenic
937665099 2:124477784-124477806 CTGCTGACACAGATTGTGATTGG + Intronic
940522059 2:154763503-154763525 CCGGGGACACAGAATGTGATAGG + Intronic
940997444 2:160164999-160165021 CTGGGAACAAAGACTGAGGAGGG - Intronic
942132914 2:172898463-172898485 GTGGGTCCACAGAGTGAGGTGGG - Intronic
943053173 2:182941538-182941560 CTGGGGCCAGAGACTGGGGTAGG + Intronic
944518010 2:200531765-200531787 CTGGGAATACACCTTGAGGTGGG - Intronic
945444471 2:209919856-209919878 CTTGGGATACAGATTGTGGCTGG - Intronic
946947031 2:224831829-224831851 CTTGGGACAGAGATTGAAGCAGG + Intronic
947444773 2:230155433-230155455 CTGGGGTCACTGATTGTGGCTGG + Intergenic
947750341 2:232528798-232528820 CTGGGGCCACAGAGTGGGGAAGG - Intronic
948467163 2:238158165-238158187 CTGGGGGCACTGATTCCGGTGGG + Intergenic
949002605 2:241625127-241625149 CTGGACACACAGAATGAGTTAGG - Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1171247697 20:23625912-23625934 CTGGGGGCACAGAATGAGGCTGG - Intergenic
1172155425 20:32820383-32820405 CTGGGGACGCACATTGTGGGAGG + Intronic
1172268735 20:33640153-33640175 CTGGGTACGGAGATGGAGGTGGG - Intronic
1172405705 20:34687323-34687345 CTTGGGTCTCAGATTGAGGAGGG - Intergenic
1172837520 20:37882568-37882590 CCGGGGACACAGAGTCAGGAGGG + Intergenic
1173648056 20:44645999-44646021 CTGTGGGCGCAGAGTGAGGTTGG - Intronic
1174121877 20:48271957-48271979 CAGGGGAAACAGCTTGAGATTGG - Intergenic
1175418322 20:58816093-58816115 CTTGAGACATAGCTTGAGGTGGG - Intergenic
1175873405 20:62218853-62218875 CAGGGGACACAGATAGTGCTGGG - Intronic
1176030823 20:63010388-63010410 CTGGGGACAGAGTTTCAGTTTGG - Intergenic
1176266053 20:64209918-64209940 TTGGGGACCCAGATTTAGGTCGG + Intronic
1177255835 21:18661947-18661969 CTGGAGACACGTAATGAGGTAGG - Intergenic
1179933985 21:44591059-44591081 CGGGGGGCACAGGGTGAGGTGGG - Intronic
1179985317 21:44917774-44917796 CTGGGGACACATGTTGGTGTTGG - Intronic
1181106155 22:20576903-20576925 CTGGGTTCACAGAATCAGGTTGG + Intronic
1181349491 22:22244923-22244945 CTGGTGACACAGATGCATGTGGG - Intronic
1181893304 22:26083975-26083997 CTAGGGACAGAGATGGAGGCAGG + Intergenic
1183004744 22:34891774-34891796 ATGGGCACACAGACTGAGGGTGG - Intergenic
1183592734 22:38789966-38789988 CTGGGGAAAAAGACTGGGGTTGG + Intronic
1185097525 22:48819538-48819560 CTGGGAACACAGATTGCAGTGGG - Intronic
949824799 3:8154263-8154285 CTTGGGACCCAGGATGAGGTTGG - Intergenic
950152115 3:10695978-10696000 CTGGGGGCTGGGATTGAGGTGGG - Intronic
950847726 3:16031163-16031185 CAGGGGACACAGAGTCAAGTAGG - Intergenic
952198993 3:31105942-31105964 CAGGGATCACAGATTGAGGATGG + Intergenic
952442807 3:33350029-33350051 CTGGGCACCCAGAATGAGTTAGG - Intronic
952922819 3:38298155-38298177 CTGGGGACACACCTTCAGTTTGG + Intronic
953235698 3:41104197-41104219 CTGGGGACACAGAAAGGGGCGGG + Intergenic
954205207 3:49053712-49053734 ATGGGGCCACAGATGGCGGTTGG + Intronic
955792976 3:62607544-62607566 ATGGGGACCCAAATTGTGGTGGG + Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
959697832 3:109268628-109268650 GTGGAGATACAGATTGTGGTAGG - Intergenic
961422242 3:126815648-126815670 CTGTGGACACAGATGGGGGGGGG - Intronic
961829935 3:129618271-129618293 TGGGGGACACACATTGGGGTGGG - Intergenic
962758848 3:138489710-138489732 CTGGCCTCACAGAATGAGGTTGG + Intergenic
963759893 3:149277193-149277215 CTAGGAACACAGTGTGAGGTGGG + Intergenic
964774129 3:160256520-160256542 CTGGGGACTCTGATTGTGGCTGG + Intronic
965962449 3:174444270-174444292 GTGGGGGCACAGATGGAGGTGGG + Intronic
969340295 4:6536080-6536102 CAGGCTACACAGAGTGAGGTGGG - Intronic
969573259 4:8022494-8022516 CTGGGGGGCCAGAATGAGGTGGG - Intronic
970974131 4:22023413-22023435 CTGGGGACACAGGTTGAGGCTGG + Intergenic
973533551 4:51857547-51857569 CTGGGAGCACAGCTTGATGTGGG + Intronic
975475873 4:74822744-74822766 CTGGGGAGAGAGAGTGTGGTTGG + Intergenic
975528191 4:75373947-75373969 CTGAGGACACAGCTAGAGGGAGG + Intergenic
975736078 4:77382530-77382552 CCGGGGACAGAAATTGAGGAGGG + Intronic
976587117 4:86811372-86811394 CTGGGGACAGAGTTTGAGAATGG + Intronic
977719195 4:100219520-100219542 CTGGCCTCATAGATTGAGGTAGG + Intergenic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
978911925 4:114074011-114074033 CTGGTTTCACAGAATGAGGTTGG - Intergenic
979615140 4:122733654-122733676 CAGGGGAGAAAGACTGAGGTAGG + Intronic
981162767 4:141518690-141518712 CTGGGGACACAGCTTCTGGCAGG - Intergenic
982323129 4:154101137-154101159 CTGGAGATACACAGTGAGGTGGG - Intergenic
984135378 4:175931116-175931138 CTGGGAACTGAGATTGAGATAGG + Intronic
984965834 4:185138924-185138946 CGGGGGAAACTGATTCAGGTTGG - Intergenic
985245505 4:187976292-187976314 GCGTGGACACAGAGTGAGGTTGG + Intergenic
986507559 5:8468359-8468381 CTTGGGTCAAAGCTTGAGGTGGG - Intergenic
986636854 5:9831153-9831175 CAGGGGAAACAGATTGCAGTTGG + Intergenic
989793146 5:45431838-45431860 CTTGTAACACAGTTTGAGGTCGG + Intronic
991546579 5:67788837-67788859 ATGGGGACTCAGAGTCAGGTTGG - Intergenic
992176460 5:74154091-74154113 GAGGGGACACAAATTGAGGCAGG + Intergenic
993547650 5:89231631-89231653 CTGGGGTCACAGACTTAGGGAGG - Intergenic
995894286 5:116994521-116994543 CTGGGGACCCAGATAGACCTGGG - Intergenic
997310681 5:132878457-132878479 CTGAGGACACCTATTGAGGAGGG + Exonic
998224467 5:140315795-140315817 CTGGGCACAGAGGCTGAGGTGGG + Intergenic
998446733 5:142204645-142204667 CTGGAGACACAGTGTGGGGTTGG - Intergenic
999186803 5:149716923-149716945 CTGGCCTCACAGACTGAGGTGGG + Intergenic
1000197306 5:158972182-158972204 CTGGGGACACAGATTGAGGTGGG - Intronic
1002640256 5:180627322-180627344 CTGGGGTCGCAGAGTGAGGCAGG + Intronic
1003240372 6:4340347-4340369 CTGGGGACACAGAATAAACTGGG + Intergenic
1003449673 6:6219123-6219145 CGGGGAAGACAGGTTGAGGTGGG + Intronic
1005983701 6:30856879-30856901 CTGTGGCCTCAGGTTGAGGTGGG - Intergenic
1006335123 6:33416362-33416384 CTGGGGGCAGAGACTGAGGAGGG + Exonic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1007219344 6:40266054-40266076 TTGAGGACCTAGATTGAGGTGGG - Intergenic
1008315437 6:50033817-50033839 CTGGCTTCACAGAATGAGGTAGG - Intergenic
1011696932 6:89921359-89921381 CTGGGCACACTGCTTGAGGGAGG + Intergenic
1013376014 6:109515005-109515027 GTGGGGACACAGATAGAAGGTGG + Intronic
1013673753 6:112434348-112434370 CGGGGGAAACATATTGAGGAAGG - Intergenic
1017608462 6:156158347-156158369 CTAGAGACAAAGATGGAGGTAGG + Intergenic
1017932175 6:158966335-158966357 CTGGTCTCACAGAATGAGGTGGG + Intergenic
1018353542 6:162988273-162988295 CTAGGGACACAGAGTGGGATTGG + Intronic
1018393526 6:163359294-163359316 CTGCGGACACAGGATGAGGGAGG + Intergenic
1019127424 6:169850100-169850122 GTGGGGACACAGCTGGAGGCAGG - Intergenic
1019794866 7:3042165-3042187 CGGGGGACACAGTTTCAGTTTGG + Intronic
1020735689 7:11946525-11946547 CTGGCCACACAGAATGAGTTAGG + Intergenic
1023022511 7:36022831-36022853 GTGGGGAGAGAGATGGAGGTGGG + Intergenic
1023992753 7:45139212-45139234 CTGGGGAGACAGAGAGAGGGCGG - Intergenic
1024015512 7:45311214-45311236 CTGGGGACAGAGATGGGGATTGG + Intergenic
1024554616 7:50592834-50592856 CTGGGGACCCAGAGCGAGATGGG - Exonic
1024672985 7:51613462-51613484 CTGGGGTCAAAGTTAGAGGTGGG + Intergenic
1024932683 7:54680391-54680413 CTGGGGACACAGAAGGTGGTGGG - Intergenic
1025030825 7:55555291-55555313 CTGGGGCCAGCGATTGAGCTGGG - Intronic
1027627151 7:80560446-80560468 CTGGCCTCACAGAATGAGGTAGG + Intronic
1027751195 7:82149076-82149098 CTGAGTACACAGACTGAGGCAGG - Intronic
1029388909 7:100261593-100261615 CTGGGGACTCCAATAGAGGTTGG + Intronic
1029504186 7:100952200-100952222 GTGGTCACACAGATGGAGGTGGG - Exonic
1032228446 7:130052814-130052836 CTGGGAACACTGATAGAGTTAGG - Intergenic
1032990263 7:137386686-137386708 CTGGGGACACAGAAAAGGGTAGG + Intronic
1034707505 7:153158663-153158685 CTAGGGACAGAGATGGGGGTTGG + Intergenic
1035205344 7:157290868-157290890 ATGGGGACAGAGATTCAGCTTGG + Intergenic
1036289439 8:7474382-7474404 CTGGGGACATAGATTAACGTAGG + Intronic
1036332038 8:7837150-7837172 CTGGGGACATAGATTAACGTAGG - Intronic
1037831838 8:22194420-22194442 GTGGGGACACAGGATGGGGTGGG - Intronic
1038726130 8:30083970-30083992 CTGGGGACACAACTTCAGGGAGG + Intergenic
1038973092 8:32659710-32659732 CTGGGGAGACAGCTGGAGTTAGG - Intronic
1039614562 8:38944758-38944780 GTAGGGACACAGATTTGGGTGGG + Intronic
1041106896 8:54453549-54453571 CCGGGGCCACAGTTGGAGGTGGG + Intergenic
1041468368 8:58180651-58180673 CTGAGGCCACAGATAGAGCTAGG - Intronic
1041843477 8:62298722-62298744 CTGGAGGAACAGATTTAGGTTGG - Intronic
1042751940 8:72167185-72167207 CTGGTCACACAGAATGAGTTAGG + Intergenic
1044924132 8:97195449-97195471 CTCTGGACACAGAGTGAGGCTGG + Intergenic
1047565911 8:126043381-126043403 CTGGCTACACAGAATGAGCTAGG + Intergenic
1050646324 9:7723604-7723626 TTGGGGAAACATCTTGAGGTGGG + Intergenic
1052301196 9:26954555-26954577 CTGAGGACATATAATGAGGTGGG + Intronic
1054343426 9:63890374-63890396 CTGTGGACTCAGATTGAGCCAGG - Intergenic
1056429427 9:86512407-86512429 ATTTGGACAAAGATTGAGGTAGG - Intergenic
1056702914 9:88925683-88925705 TTTGGGACACAGATGGAGGAAGG - Intergenic
1057164634 9:92916087-92916109 CTGGCTACACAGAATGATGTTGG - Intergenic
1057718780 9:97516285-97516307 CTGGGAACACAGAGAGATGTGGG + Intronic
1059529573 9:115023498-115023520 CTGAGGTCACAGAGTGAAGTTGG - Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060209284 9:121700047-121700069 CTGGGGGCACAGCCTGAGGCTGG + Intronic
1061103209 9:128508292-128508314 CTGGGGAGACTGGTTGAGGTGGG + Intronic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1061826074 9:133258993-133259015 ATGGGGACAGAGCTTCAGGTTGG + Intronic
1186367094 X:8906987-8907009 CTAAGGACACAGAGTGAGGTAGG + Intergenic
1186739559 X:12503196-12503218 CTGGGGATAGAGATGGGGGTTGG + Intronic
1188654864 X:32680770-32680792 CTGGGGAGAAAGGTTGGGGTGGG - Intronic
1190013383 X:46804976-46804998 CTGGGGGCAGGGAGTGAGGTGGG - Intergenic
1190119162 X:47646401-47646423 CTGGGCACAGAGGCTGAGGTGGG - Intronic
1191884498 X:65874575-65874597 CAGGGGAGACAGACTGGGGTTGG + Intergenic
1193223585 X:78955697-78955719 CAGGGCTCACAGACTGAGGTGGG - Intronic
1194177541 X:90668934-90668956 CTGGCTACACAGAATGAGTTAGG - Intergenic
1194251763 X:91584698-91584720 CTGGGCACATAGAATGAGTTAGG + Intergenic
1194423699 X:93709482-93709504 TTGGGCCCACAGATTGAGTTGGG - Exonic
1195993278 X:110704664-110704686 CTGGGGACAGTGATTGAGCAGGG + Intronic
1196189514 X:112780136-112780158 CTGTTGACACAGATTGAGTGTGG + Intronic
1198030594 X:132750140-132750162 CTGGCCCCACAGATTGTGGTGGG - Intronic
1198703169 X:139418628-139418650 CTGGGGACTGAGAGAGAGGTTGG + Intergenic
1199194909 X:145016839-145016861 CTGGCCTCACAGAATGAGGTTGG - Intergenic
1199714351 X:150495669-150495691 CTGGGGACACAGAGTCAGAGAGG + Intronic
1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG + Intergenic
1200524212 Y:4251081-4251103 CTGGCTACACAGAATGAGTTAGG - Intergenic
1200570698 Y:4825929-4825951 CTGGGCACATAGAATGAGTTAGG + Intergenic