ID: 1000199726

View in Genome Browser
Species Human (GRCh38)
Location 5:158996251-158996273
Sequence CCCGGACATGTTTGTTGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 37}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000199726_1000199729 25 Left 1000199726 5:158996251-158996273 CCAGATCAACAAACATGTCCGGG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1000199729 5:158996299-158996321 TAATGTCTTAATATACTTCCTGG 0: 1
1: 0
2: 0
3: 15
4: 209
1000199726_1000199730 26 Left 1000199726 5:158996251-158996273 CCAGATCAACAAACATGTCCGGG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1000199730 5:158996300-158996322 AATGTCTTAATATACTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000199726 Original CRISPR CCCGGACATGTTTGTTGATC TGG (reversed) Intronic
913439757 1:118885050-118885072 CCCGAACATGTGTGGTGATGAGG + Exonic
920992060 1:210948862-210948884 CCCGGGCATGTTTCTTCATCTGG - Intronic
1068559078 10:58492437-58492459 CCTGGACATTTTTGTTTCTCTGG + Intergenic
1071472554 10:85994068-85994090 CCAGGACATGTTTGATTAGCTGG - Intronic
1080764956 11:35287464-35287486 GCTGGACATGTTTGTTGTTATGG - Intronic
1094170062 12:27481506-27481528 CCCGGACCTGTTTGGTTTTCTGG + Intronic
1108638080 13:52356122-52356144 TCCTTACATGTCTGTTGATCAGG - Intergenic
1118345609 14:64938660-64938682 ACCCGAGATGTTTGATGATCAGG + Intronic
1128689335 15:69711364-69711386 CCTGGACAGGTGTGTTGATGGGG + Intergenic
1131402931 15:92141043-92141065 ACCTGACAAGTTTGTTGACCCGG - Intronic
1132227955 15:100157706-100157728 CCATGACAAGTGTGTTGATCTGG + Intronic
1134052730 16:11148203-11148225 CCAGTACCTGTTTGTTGTTCCGG + Intronic
1141108792 16:81255083-81255105 CCAGGTCCTGTTTCTTGATCAGG + Intronic
1153121917 18:1739148-1739170 CCCAGACACTTTTGCTGATCAGG - Intergenic
1157572636 18:48723228-48723250 CCCGTGCATGTGAGTTGATCAGG - Intronic
1164026326 19:21356574-21356596 TTTGGACATGTTTGTTGATGTGG + Intergenic
1172158524 20:32847318-32847340 TCACGACATGTTAGTTGATCAGG + Intronic
953801242 3:46024268-46024290 CCCGGAAATGTTTCATCATCTGG + Intronic
959068423 3:101680262-101680284 CCCGGAGTAGTTTGTTGAGCTGG - Intergenic
966772664 3:183517851-183517873 CTCGGACATGATTGATGCTCAGG + Intronic
968029028 3:195466967-195466989 CACGGCCATGTTTGGTGATGGGG + Intergenic
969411180 4:7029370-7029392 TCCGTACATGTCTGTTGTTCAGG + Intronic
975465050 4:74699396-74699418 CCCAGACATGCTTGTAGCTCAGG + Intergenic
982559136 4:156907821-156907843 ACTGGACATGTTTGGTGACCTGG - Intronic
983796823 4:171874574-171874596 CCCAGCCATGGTTGATGATCAGG - Intronic
986863929 5:11962098-11962120 TCCAGATATATTTGTTGATCTGG + Intergenic
987899007 5:23986473-23986495 TTAGGTCATGTTTGTTGATCTGG + Intronic
990868744 5:60408083-60408105 CCCTCACATGTCTGGTGATCAGG - Intronic
991083579 5:62626922-62626944 CCTGAACATGTTTTCTGATCAGG - Intronic
1000199726 5:158996251-158996273 CCCGGACATGTTTGTTGATCTGG - Intronic
1006605486 6:35253689-35253711 ACCCCACATGTTTTTTGATCAGG - Intergenic
1015106857 6:129546911-129546933 CCAGGAAATGTTTGTTGAAGGGG + Intergenic
1017752146 6:157497845-157497867 CTTGAAAATGTTTGTTGATCAGG - Intronic
1021344229 7:19504023-19504045 CCTGGAAATGTTTATTGACCTGG + Intergenic
1032293741 7:130615487-130615509 CCCCAACAAGTTTTTTGATCAGG + Intronic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1047548247 8:125840331-125840353 CCCAGAAATGGTTATTGATCAGG + Intergenic
1053174387 9:35911697-35911719 CCAGGACCTGTTTGTTGAGGGGG + Intergenic
1189744897 X:44158953-44158975 CCAAGACATGTTTGTAGCTCAGG - Intronic