ID: 1000199917

View in Genome Browser
Species Human (GRCh38)
Location 5:158997994-158998016
Sequence CAGAATGAGGAGGAGGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 645
Summary {0: 1, 1: 0, 2: 3, 3: 68, 4: 573}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000199917_1000199923 11 Left 1000199917 5:158997994-158998016 CCTGCTACCTCCTCCTCATTCTG 0: 1
1: 0
2: 3
3: 68
4: 573
Right 1000199923 5:158998028-158998050 TCAGGACACTGACCTCCTCTAGG 0: 1
1: 0
2: 2
3: 26
4: 263
1000199917_1000199922 -7 Left 1000199917 5:158997994-158998016 CCTGCTACCTCCTCCTCATTCTG 0: 1
1: 0
2: 3
3: 68
4: 573
Right 1000199922 5:158998010-158998032 CATTCTGAAAGGCTCAATTCAGG 0: 1
1: 0
2: 1
3: 13
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000199917 Original CRISPR CAGAATGAGGAGGAGGTAGC AGG (reversed) Intronic
900297195 1:1957729-1957751 CAGGCTGAGCAGGAGGGAGCCGG + Intronic
900361383 1:2290664-2290686 CAGGAGGAGGAGGAGGAAGAGGG + Intronic
900419724 1:2550686-2550708 CAGGAAGAGGAGGAGGCAGCCGG + Intergenic
901908367 1:12433891-12433913 TACAAAGAGGAGGAGGTAGGGGG + Intronic
902237040 1:15064161-15064183 CAGAGTGAGGAGGGGGCTGCAGG + Intronic
902611883 1:17602559-17602581 CAGAAAGAGAGGGAGGCAGCAGG + Intronic
902651029 1:17837680-17837702 TAGAATGAGGAGGTTGGAGCAGG + Intergenic
902688989 1:18097900-18097922 GAGAAAGAGGAGGAGGTGTCAGG - Intergenic
902961569 1:19967053-19967075 GAGAAGGAGGAGGAGGAAACAGG - Intergenic
903493810 1:23750912-23750934 CAGAAGGAGGAGGAGATGGAGGG + Exonic
903644521 1:24886522-24886544 CAGAAAGAGGAGGGAGTGGCTGG - Intergenic
903760307 1:25693276-25693298 CAGGCTGAGGAGGAGGAAGTGGG + Intronic
903864761 1:26389918-26389940 CAGAATGAGGAGGAAGGGGCAGG + Intergenic
903934090 1:26882866-26882888 CAGGAAAAGGAGGAGGGAGCAGG - Intronic
904233374 1:29096341-29096363 GAGAAGGAGGAGGGGGCAGCTGG + Intronic
904348631 1:29890573-29890595 CAGGGTGAGGAAGAGGTAACTGG + Intergenic
904421610 1:30398063-30398085 CAGGATGAGGAGGGCGTAGGAGG + Intergenic
904920132 1:34000961-34000983 TAGAAAGAGGAGGAGGAAGGAGG + Intronic
905258786 1:36703088-36703110 GAGAAAGAGGAGGAGGTGCCAGG + Intergenic
905458374 1:38104255-38104277 CAGGATGAGTAGGAGTTATCAGG + Intergenic
905575804 1:39043745-39043767 AAGAAGGAGGAGGAGGCGGCAGG + Intergenic
905622211 1:39458011-39458033 GAGAAAGAGGAGGAGATAGCAGG + Intronic
905855346 1:41307837-41307859 CAGAGTCAGGAGGAGGGACCAGG - Intergenic
906004154 1:42454976-42454998 CAGAATGAGTAGAAAGTATCAGG - Intronic
906513462 1:46424433-46424455 CTGAATGGGGTGGAGGTAGGAGG - Intergenic
907537001 1:55171883-55171905 AAGGAAGAGGAGGAGGTAACAGG + Intronic
907654431 1:56327719-56327741 AAGAAGGAAGAGGAGGCAGCAGG + Intergenic
908318839 1:62961628-62961650 CAGAATGGGGAGGAGGGGGGTGG - Intergenic
908730066 1:67216947-67216969 CAGAAAGGGGAGGAGGTTGTAGG + Intronic
910033321 1:82759024-82759046 GAGAAACAGGAGGAGGAAGCAGG - Intergenic
911015393 1:93326453-93326475 GAGAATGAGGATGAGGGAGGAGG + Intergenic
912164866 1:107031060-107031082 AAGAATGAGGATGAGGGAGGAGG - Intergenic
912513026 1:110201315-110201337 CTGGAGGAGCAGGAGGTAGCAGG + Exonic
913046147 1:115075042-115075064 CAGACTGTGGAGGAGGTGACTGG + Intronic
913413516 1:118578923-118578945 CATAATGTGGAGGAGGTAGAGGG + Intergenic
914197065 1:145453043-145453065 CAGATGGAAGAGGAGGGAGCAGG - Intergenic
914896540 1:151680297-151680319 CCGGATGTGGAGGAGGGAGCAGG - Intronic
914993103 1:152515480-152515502 CAGCAGGAGGAGGAGGAGGCGGG - Exonic
915086942 1:153395417-153395439 CAGAATGAGGTGGAGGTTTCAGG - Intergenic
915840434 1:159208578-159208600 GGGGATGAGGAGGATGTAGCAGG - Intergenic
916014114 1:160733293-160733315 CAGATGGAGGAGGAGGTAGAAGG + Intergenic
916289136 1:163144635-163144657 GAGGAGGAGGAGGAGGGAGCTGG + Intronic
917270713 1:173270427-173270449 CAGAAGGTTGAGGAGGAAGCAGG + Intergenic
917374364 1:174333163-174333185 GAGAATGAGGAGAGGGTAGATGG + Intronic
918069511 1:181124592-181124614 CAGAAGGAGGAGGAGGAGGGAGG - Intergenic
919750464 1:201034630-201034652 CAGAATGGGGAGGAGCTCCCTGG - Intergenic
920537121 1:206745054-206745076 CAGAAAGAGCAGGAGGTATCTGG - Intergenic
921143184 1:212325446-212325468 CACATTGAGGAGGTGGTAGTGGG + Intronic
921458055 1:215395410-215395432 AAAAATGAGGAGGAGTTGGCTGG - Intergenic
921945405 1:220882763-220882785 CAGCAGGAGGAGGAGGAAGGAGG - Intronic
922506292 1:226127909-226127931 CAGACTTAGGAGGAGGTACCGGG - Intergenic
923126220 1:231036781-231036803 CAGAATGTGGAGCTGGAAGCTGG - Intronic
923218197 1:231869611-231869633 AAGAAAGAGGAGGAGGTGCCAGG + Intronic
923748383 1:236724436-236724458 CAGGATGAAGGGGAGGGAGCAGG + Intronic
923942178 1:238840616-238840638 CAGAAAGAACAGGAGTTAGCAGG - Intergenic
924057616 1:240139286-240139308 CACAATGAGGAGCAGGTTGTGGG + Intronic
924604151 1:245517766-245517788 AAGAATGAGCAGGAGGTGGCTGG + Intronic
1063604028 10:7507392-7507414 CAGACTAAGAAGGATGTAGCAGG + Intergenic
1064143257 10:12807644-12807666 CAGGACAAGGAGCAGGTAGCCGG - Intronic
1064322085 10:14314840-14314862 GTGAATGAGGAGGAGATAGGAGG - Intronic
1065150816 10:22821339-22821361 CAAAATGAGGAGGAGCTTGAAGG + Intergenic
1066068360 10:31778792-31778814 GAGGGTGAGGAGGAGTTAGCTGG - Intergenic
1066226882 10:33392496-33392518 GAGAATGAGGATGAGGAAGAGGG - Intergenic
1066229584 10:33419402-33419424 GAGAGTTAGGAGGAGGAAGCTGG + Intergenic
1066415079 10:35214260-35214282 AAGAATGAGGAGGAAGGATCTGG - Intergenic
1066449250 10:35512901-35512923 GATGATGAGGAGGAGGAAGCAGG - Intronic
1068117785 10:52752962-52752984 CAGAGTGAGGAGCAGTGAGCAGG - Intergenic
1068412668 10:56677743-56677765 AAGGAAGAGGAGGAGGAAGCAGG + Intergenic
1069415811 10:68199983-68200005 CAGAATGAGTAGGAGGTGCCAGG - Intronic
1069578893 10:69551635-69551657 CAGAATGCGGAGGTGGGAGTGGG - Intergenic
1070555008 10:77520735-77520757 GGGAATGAGGATGAGGGAGCAGG - Intronic
1071120705 10:82274352-82274374 CAGAATTAGAAGAAGGTTGCAGG - Intronic
1071277438 10:84068614-84068636 GAGAGTGAGGAGGAGGTATCAGG - Intergenic
1071335993 10:84601001-84601023 CAGAATTTGGAGGAGCTGGCAGG - Intergenic
1071400885 10:85269549-85269571 GAGAGAGAGGAGGAGGTGGCAGG + Intergenic
1071555475 10:86598183-86598205 CAGTATGAGGAGGTGGTAGGGGG + Intergenic
1071603236 10:86969087-86969109 CAGAATACGGAGGAGAGAGCTGG - Intronic
1072539524 10:96387680-96387702 CATAATGAGGCTGAGTTAGCAGG + Intronic
1072918323 10:99554294-99554316 AAGAAGGAGTAGGAGGTGGCTGG - Intergenic
1073248289 10:102106839-102106861 AGGAAGGAGGAGGAGGCAGCCGG - Intergenic
1073759831 10:106617291-106617313 CAGAGAGAGGAGGAGGCAGAAGG - Intronic
1074166628 10:110884152-110884174 CAGGATGAGGTGGATGAAGCTGG - Intronic
1074519659 10:114207653-114207675 AAGAATGAGGAAGATGAAGCTGG + Intronic
1075083695 10:119400318-119400340 AAGGATGTGGAGGAGGAAGCTGG + Intronic
1075288177 10:121205021-121205043 CAGACAGAGGTGGAGGTGGCAGG - Intergenic
1075396892 10:122134019-122134041 CAAAACTAGGAGGAGGTACCTGG + Intronic
1075899910 10:126033156-126033178 CTGAATGAGGAGTAGGGAACTGG - Intronic
1076280572 10:129242925-129242947 CAGCATGAGGATGAGGCTGCTGG - Intergenic
1076446629 10:130518640-130518662 CAGGATGAGGGGGAGCCAGCAGG - Intergenic
1076768958 10:132652633-132652655 CCCCATGAGGAAGAGGTAGCTGG - Intronic
1077748051 11:4930536-4930558 CAGAATGAGGATTGGGTAGATGG - Intronic
1078181568 11:9015997-9016019 GAGAATGAGGAGGTGGTGGGAGG - Intergenic
1078652883 11:13212389-13212411 CTGAAAGAGGAGGAGGTATGTGG + Intergenic
1078825967 11:14930635-14930657 CAGTATGGGGAGGAGGTATCTGG + Intronic
1079141350 11:17812070-17812092 CAGAAGGGGCAGGAGGCAGCTGG + Intronic
1079172080 11:18105977-18105999 GAGGAGGAGGAGGAGGTGGCCGG - Exonic
1079214445 11:18495717-18495739 GGGAATGAGGAGGTGGTAGTCGG - Intronic
1079661396 11:23041321-23041343 TAGAATGAGGATGAGGAAGTGGG - Intergenic
1080872366 11:36248096-36248118 AAGAAGGAGGAGGAGGAAGAGGG - Intergenic
1080881068 11:36321334-36321356 CAGGATCTGGAGGAGGAAGCAGG - Intronic
1080882197 11:36332742-36332764 CAGCAGGAGGAGGAGGTGCCAGG - Intronic
1081227661 11:40544356-40544378 CAGAATGAGAAGGAGGTCATGGG - Intronic
1081886907 11:46505762-46505784 GAGAGAGAGGAGGTGGTAGCAGG + Intronic
1082791347 11:57348435-57348457 CAGCAGGAGGAGGAGGCAGGTGG - Intronic
1082802122 11:57422752-57422774 CTGAATGTGGAGGTGGTGGCTGG - Intronic
1082862563 11:57869856-57869878 GAGAATGGGGAGGAGGTGCCAGG + Intergenic
1083188218 11:61030514-61030536 CAGAATGGGAAGCGGGTAGCAGG - Intergenic
1083374453 11:62208323-62208345 TAGAAGGAGGAGGAGGAAGAAGG + Intergenic
1083540539 11:63508948-63508970 GAGAAAGAGGATGAGGAAGCTGG - Exonic
1085206527 11:74736657-74736679 CAGCAAGAGGAGGAAGTATCAGG + Intergenic
1085548371 11:77342767-77342789 CAGTAACAGGAAGAGGTAGCTGG + Intronic
1086165219 11:83769916-83769938 CAGACTTAGGAAGAGGAAGCAGG - Intronic
1086327144 11:85713719-85713741 CAGAATGAGTATTAGGTACCTGG + Intronic
1087407105 11:97744290-97744312 GAAAATGAGAATGAGGTAGCTGG - Intergenic
1087595263 11:100245497-100245519 TATAATGAGGAGGAGGCAGAGGG + Intronic
1087743428 11:101915207-101915229 GAGCAGGAGGAGGAGGAAGCCGG + Exonic
1089058787 11:115608996-115609018 CAGAATGAGGAGGAGGGCACAGG - Intergenic
1089104276 11:115989310-115989332 CAGAAGGATGAAGAGGGAGCCGG - Intergenic
1089163263 11:116455827-116455849 AAGGATGAGTAGGAGTTAGCAGG + Intergenic
1089313252 11:117573894-117573916 CAGAGGGAGGAGGCAGTAGCTGG - Intronic
1089763868 11:120749017-120749039 CAGCAGGAGGAGGAGATAGTAGG - Intronic
1089860484 11:121586175-121586197 AAGAATGACGAGGAGGAAACAGG - Intronic
1090354853 11:126133456-126133478 AAGACTAAGGAGGAAGTAGCAGG - Intergenic
1090467885 11:126951467-126951489 CAGTGTGAGAAGGAGGTATCAGG + Intronic
1090778392 11:129984879-129984901 GATAATGAGAAGGAGGTAGGTGG - Intronic
1091074181 11:132599357-132599379 GAGAAGGAGGAGGAGGAAGAAGG + Intronic
1092901377 12:13062676-13062698 CTTACTGAGGAGGAGGAAGCAGG - Intronic
1094129903 12:27063588-27063610 CAGGAGGAGGAGGAGGAAGAAGG - Intronic
1094342265 12:29425912-29425934 CATAATGAGCAGGATGTAGAAGG - Intronic
1095170502 12:39029539-39029561 CTAAAGGAGAAGGAGGTAGCTGG + Intergenic
1096883196 12:54689402-54689424 CAGAATGTGGAAGATGTATCAGG + Intergenic
1098232581 12:68387629-68387651 CTGAATGATGAGGAGGAACCAGG - Intergenic
1098495894 12:71135328-71135350 GAGAAGGAGGAGGAGGAAGAAGG + Intronic
1099659979 12:85545148-85545170 AAGGAGGAGGAGAAGGTAGCAGG - Intergenic
1099902404 12:88727978-88728000 CAGAATAATGAGGAGATAGTAGG + Intergenic
1099953366 12:89328414-89328436 CAGAAGCTGGAGGAGGCAGCTGG - Intergenic
1100357206 12:93842701-93842723 CTGAGGGAGGAGGAGGTAGCTGG + Intronic
1101648881 12:106656677-106656699 GAGAATGAGGAGAAGGGAGATGG - Intronic
1102591393 12:113959226-113959248 GAGAGTGAGGAGGAGGGAGCCGG - Exonic
1102725816 12:115063667-115063689 AAGACAGAGGAGGAGGTACCAGG - Intergenic
1102882198 12:116494109-116494131 AAGGAGGAGGAGGCGGTAGCAGG + Intergenic
1103005088 12:117414632-117414654 CAGGAAGAGGAGGAGGAAGGAGG - Intronic
1103411675 12:120716636-120716658 GAGGATGAGGAGGAGGGAGGTGG + Exonic
1103889820 12:124229991-124230013 CAGAATGAGGCAGAAGTGGCTGG + Intronic
1105451263 13:20502335-20502357 CTGAGTGAGGAGGGGGAAGCGGG - Intronic
1105879321 13:24590103-24590125 CGGAGTGAGGAGGGGGTGGCAGG - Intergenic
1105920514 13:24958955-24958977 CAGAGTGGGGAGGGGGTGGCAGG + Intergenic
1106658846 13:31777127-31777149 CAGCAGGAGGTGGAGGCAGCAGG + Intronic
1107163803 13:37262702-37262724 CAGAATCAGGAGGAGGTGAGAGG + Intergenic
1107413051 13:40175238-40175260 GAGGATGAGGGGGAGCTAGCTGG - Intergenic
1107890061 13:44906260-44906282 CAGGAGGAGGAGGAGGGAGGAGG + Intergenic
1109397779 13:61783115-61783137 CTGAATGATGAGGAGGAACCAGG - Intergenic
1109621701 13:64916804-64916826 AAGAGTGAGGAGGAGGAAGGAGG - Intergenic
1110643510 13:77854403-77854425 TACAATGAGGAGGAAATAGCGGG - Intergenic
1110761777 13:79238626-79238648 AAGAAAGAGGAGGAGGAAGAGGG + Intergenic
1111927234 13:94476870-94476892 ACGAATGAGGAGCAGGTTGCTGG - Intronic
1112104752 13:96228864-96228886 CAGAAGGAGGAAGAGGGACCAGG + Intronic
1113059325 13:106304666-106304688 CAGACTGTGGAGGAGGGAGGTGG + Intergenic
1113566745 13:111323851-111323873 AAGGAGGAGGAGGAGGAAGCTGG - Intronic
1113619349 13:111702388-111702410 CAGCATGAGGAGGACGTGGGAGG + Intergenic
1113624878 13:111787649-111787671 CAGCATGAGGAGGACGTGGGAGG + Intergenic
1114181550 14:20372275-20372297 CAGAATGAGTAGGAGTTTTCTGG - Intronic
1114201221 14:20522575-20522597 GAGAAGGAGGAGGAGGGAGGAGG + Intergenic
1114400409 14:22405135-22405157 GAGAGAGAGGAGGAGGTACCAGG - Intergenic
1115094538 14:29618967-29618989 GAGAATGAGGAGGAGGAAGGGGG + Intronic
1115761717 14:36582848-36582870 CAGGAGGAGGAGGAGGAAGCTGG - Intergenic
1117386732 14:55221925-55221947 CAAAAGGAGGAGGAGGAAGATGG - Intergenic
1119278250 14:73380365-73380387 CAGAAGGAGGAGCAGGTTGAAGG + Intronic
1119369512 14:74127321-74127343 AAGAATGAGTAGGAGTTAACTGG + Intronic
1119996832 14:79262441-79262463 GAGAAAGAGGAGGAGGAAGGAGG + Intronic
1120306945 14:82782845-82782867 CAGACAGAGGAGGAGGAAGAAGG - Intergenic
1120673985 14:87397479-87397501 CAGAATTAGAAGGAGGAAGGGGG - Intergenic
1121737475 14:96228531-96228553 CTGAATGTGGAAGAGGCAGCTGG - Intronic
1122357383 14:101131886-101131908 CAGAAGTAGGAGGAGGGAGGAGG - Intergenic
1122364107 14:101184010-101184032 CAGAATGAGGTGGACCCAGCAGG + Intergenic
1122569693 14:102687891-102687913 AAGAATGAGTAGGAGTTTGCTGG + Intronic
1122799702 14:104223414-104223436 CAGAGAAAGGAGGAGGCAGCTGG - Intergenic
1126143233 15:45454555-45454577 CAGGGTGTGGAGGAGGCAGCGGG + Intergenic
1127973902 15:63983335-63983357 CAGTTTCAGGAGGAGGAAGCGGG + Intronic
1128328641 15:66741484-66741506 TAAAATGAGGAGGAGGTGGGTGG + Intronic
1128549113 15:68586395-68586417 AAGGATGAGTAGGAGGTAGCAGG + Intronic
1128732482 15:70030656-70030678 CAGAGGGAGAAGGAGGTGGCTGG - Intergenic
1129498040 15:76005821-76005843 GAGAAAGAGGAGGAGTTGGCAGG + Intronic
1129791190 15:78341544-78341566 CAGGAGGAGGAGGAGGTTGCAGG + Intronic
1129934346 15:79437281-79437303 CAGAATGGGGAGGAGTGAGTAGG + Intronic
1130179735 15:81612928-81612950 CAGGAGGAGGAGGCGGGAGCAGG - Intergenic
1130312451 15:82767290-82767312 AAGAATGCTGAGGAGGTAACTGG + Intronic
1131073908 15:89483032-89483054 CAGAATGGGGATGAGGTGGTGGG - Intronic
1131821740 15:96280887-96280909 AAGAAGGAGGAGGAGGAGGCAGG + Intergenic
1132302275 15:100783440-100783462 CAGAATGATGAGGAGATCACAGG - Intergenic
1133102220 16:3486397-3486419 CAGCCTGAGGAGGAGGGAGAGGG + Exonic
1133392737 16:5422708-5422730 GAGAAAGAGGAGGAGGGAGAGGG + Intergenic
1134842746 16:17414751-17414773 CACAGTGAGGAGGTGGTGGCAGG - Intronic
1136138835 16:28275951-28275973 AAGAATGAGGAGGACGGAGTGGG + Intergenic
1137497685 16:48983408-48983430 GAGAATGAGCAGGAGCTACCAGG + Intergenic
1137591477 16:49696655-49696677 CACAATGAGGGGGAGGTAGCCGG - Intronic
1138153973 16:54685886-54685908 GAGAAGGAGGAGGAGGGAGCAGG - Intergenic
1138541615 16:57691106-57691128 GAGAAGGAGGAGGAGGAAGAAGG + Intergenic
1138746629 16:59370232-59370254 CTGAAACAGGAGGAGGTTGCCGG - Intergenic
1139120609 16:64011872-64011894 CAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1139201340 16:64980608-64980630 AAGAATGAGATGGAGGTAGAGGG + Intronic
1139482732 16:67239478-67239500 GAGACTGAGGAAGAGGTGGCAGG + Intronic
1140033653 16:71357495-71357517 GAGAATGAAAAGGAGGTCGCTGG - Intergenic
1140342487 16:74178312-74178334 CAGAATGAGAAGGAGAAAGAAGG + Intergenic
1140852540 16:78948568-78948590 CAGAGGGATGAGGAGGCAGCAGG - Intronic
1141775722 16:86121612-86121634 AAGAAGGAGGAGGAGGGAGGAGG - Intergenic
1141908245 16:87041614-87041636 CAGGATGTGGAGGAGGAACCAGG - Intergenic
1142028138 16:87825219-87825241 CTGAAGGAGGGCGAGGTAGCAGG + Intergenic
1142259324 16:89035235-89035257 GAGAATGAAGAGGAGGGAGGGGG - Intergenic
1142986878 17:3700809-3700831 GAGAGAGAGGAGGAGGTACCAGG - Intergenic
1143035221 17:3991298-3991320 GAGAAAGAGGAGGAGGAGGCCGG - Intergenic
1143165418 17:4895048-4895070 CAGAAGGAGGAGGAGGTGGGAGG - Intronic
1143301047 17:5910887-5910909 AAGGATGAGGAGGAGGTAGAGGG + Intronic
1143483412 17:7239494-7239516 GAGGAGGAGGAGGAGGGAGCAGG - Exonic
1144222653 17:13114044-13114066 CAGAATGAGGGCGAGGTCTCCGG - Intergenic
1144580527 17:16456490-16456512 GAGGAAGAGGAGGAGGAAGCTGG + Intronic
1145221625 17:21094204-21094226 GAGAAAGAGGAGGAGGGAGAGGG + Intergenic
1145770277 17:27487816-27487838 CCGAGAGAGGAGGAGGTACCAGG + Intronic
1145775585 17:27525771-27525793 CTGAAAGAGGATGAGGTAGTTGG + Intronic
1146397822 17:32482856-32482878 CAGACTGAAGAGGATTTAGCAGG - Exonic
1147445229 17:40471283-40471305 AAGAATGAGGAGGGGGTAGGAGG - Intergenic
1147498807 17:40942511-40942533 AAGAAGGAGGAGGAGGGAGAAGG - Intergenic
1147498848 17:40942743-40942765 AAGAAGGAGGAGGAGGGAGAAGG - Intergenic
1147498858 17:40942804-40942826 AAGAAGGAGGAGGAGGGAGAAGG - Intergenic
1147769376 17:42857027-42857049 CAGGAGGAGGAGGAGGAAGTAGG - Exonic
1148025606 17:44585542-44585564 CAGAAAGAGGAGGTGGCAGCAGG - Intergenic
1148490065 17:48017632-48017654 CAGAAAGAGGAAGAGGTAAGAGG + Intergenic
1148536468 17:48443112-48443134 AAGCATGAGTAGGAGTTAGCTGG - Intergenic
1148555600 17:48577120-48577142 CAGAAGGAAGAAGAGGTGGCGGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149171907 17:53822357-53822379 CAAAATGAGTAGAATGTAGCAGG - Intergenic
1149485827 17:57042074-57042096 GAAAATGAGGAGGAGGAATCCGG + Intergenic
1150067856 17:62126349-62126371 CAGGAAGAGCAGGAGGTAGAAGG - Intergenic
1150176492 17:63062647-63062669 CAAAATGGGGAGGAGGGGGCTGG - Intronic
1150802839 17:68295210-68295232 CAGCATGAGAAGAAGGTAGGAGG + Intronic
1151487495 17:74410419-74410441 CAGCATGGGGCTGAGGTAGCAGG - Intergenic
1151546750 17:74797940-74797962 CAGAATGACCAGGGGGCAGCGGG - Intronic
1151860839 17:76760376-76760398 GAGAAGGAGGAGGAGGGAGGGGG + Intronic
1151888738 17:76939665-76939687 CAGAGTGGGGAGGAGGAAGGGGG - Intronic
1152336643 17:79702876-79702898 GAGAAGGAGGAGGAGGAAGAGGG - Intergenic
1152598362 17:81249221-81249243 GAGAAAGAGGAGGAGGGAGAAGG + Intronic
1153185227 18:2478801-2478823 GAGAAAGAGGAGGAGGAAGAAGG + Intergenic
1153185232 18:2478823-2478845 GAGAAGGAGGAGGAGGAAGATGG + Intergenic
1153522169 18:5963480-5963502 GAGGATGAGGTGGAGGTGGCAGG - Intronic
1154031231 18:10756006-10756028 GAGAATGAGGAGGAGGGATGGGG + Intronic
1154031389 18:10756798-10756820 GAGAATGAGGAGGAGGAATGGGG + Intronic
1155121786 18:22828285-22828307 AAGACTGAGAAGGAGGTAGCTGG - Intronic
1156869952 18:41933961-41933983 CAGAGTGAGTATGAGATAGCAGG - Intergenic
1157768094 18:50318020-50318042 GAGAGAGAGGAGGAGGTACCAGG - Intergenic
1158571990 18:58604019-58604041 CAGCATGAGGAGGAGAATGCAGG + Intronic
1159546878 18:69850861-69850883 GAGAAGGAGGAGGAGGAAGAAGG - Intronic
1159807541 18:72974343-72974365 CAGAATGAGCAGGGGAAAGCCGG - Intergenic
1159833125 18:73303061-73303083 CAGGATGAGGAGGAGGATGAGGG - Intergenic
1160225871 18:77010031-77010053 CAGAGTGAGGAGGAGTGAGCGGG + Intronic
1161270307 19:3386000-3386022 CAGAATGAGGAGGATGGGCCGGG - Intronic
1161509588 19:4663110-4663132 TAGAATGAGGATGAGGTGGGTGG - Intronic
1161509650 19:4663375-4663397 TAGAATGAGGATGGGGTAGGTGG - Intronic
1161509762 19:4663819-4663841 CAGAATGAGGATGGGGTGGGTGG - Intronic
1161619955 19:5292747-5292769 CAGAAGGCGGAGGAGGCAACAGG - Intronic
1161989038 19:7673504-7673526 AAGGATGAGGAGGAGGAAGGAGG - Intergenic
1162100678 19:8336778-8336800 CACGATGAGGAGGAAGCAGCTGG + Intronic
1162152915 19:8658168-8658190 CAGAATGATCAAGAGGTAGCAGG + Intergenic
1162339206 19:10081735-10081757 GAGAAGGAGGAGGAGGGAGGAGG + Intergenic
1162463172 19:10825236-10825258 AAAAATGAGAAGGAGGTAGCTGG + Intronic
1162465072 19:10834992-10835014 CAGGATGACGAGGAGGTCGAAGG - Exonic
1162502076 19:11059837-11059859 GAGAGTGAGGAGGAGGAAGAGGG + Exonic
1162811690 19:13167916-13167938 CAGGATGAGGTGGCGGTAGGTGG + Intergenic
1163369612 19:16894533-16894555 CTAAATGAGGAGGTGGCAGCTGG - Intronic
1163460784 19:17436272-17436294 CAGAATGAGGAGGTGAAGGCTGG + Exonic
1164512005 19:28905078-28905100 CTGAGTGAGGAGCAGGGAGCTGG - Intergenic
1165412397 19:35670211-35670233 CTGAGTGAGGAGGAGGTTGGGGG + Intronic
1165545142 19:36528811-36528833 CAGGATCAGGAGGAGGTTGGAGG + Intergenic
1165549699 19:36573566-36573588 CAGAATGGGGAACAGGAAGCTGG + Intronic
1165821183 19:38677099-38677121 AAGAATGAGGAGGAGGTAGGTGG - Intronic
1166301233 19:41913155-41913177 CCGAGTGAGGAGGAGGCTGCGGG - Intronic
1166366088 19:42279265-42279287 CAGAGGGATGAGGAGGGAGCTGG - Intronic
1166813632 19:45528569-45528591 ACCAATGAGGAGGAGGTAGGTGG + Exonic
1166895836 19:46021568-46021590 CATTCTAAGGAGGAGGTAGCTGG + Intronic
1167775658 19:51553045-51553067 GAGAAGGAGGAGGAGGGAGAGGG + Intergenic
1167925937 19:52821113-52821135 CAGCAAGAGGAGGAGGGAGGTGG + Intronic
1167930123 19:52857099-52857121 CAGCAAGAGGAGGAGGGAGGTGG + Intronic
1168185323 19:54696661-54696683 CAGGGTGAGGAGGAGGGACCTGG - Intronic
1168337631 19:55605524-55605546 CGGAAAGAGGAGGCGGTGGCGGG - Intronic
1168565827 19:57422399-57422421 CAGGAGGTGGAGGAGGTTGCAGG - Intronic
925422081 2:3720482-3720504 CAAGATGAGGAGGAGGTCGAAGG + Intronic
925459253 2:4045511-4045533 AAGAATGAGGAGGTGCTAACTGG - Intergenic
925879260 2:8337861-8337883 CAGAATGGGGAGAAGGTAACAGG + Intergenic
925911700 2:8578013-8578035 CACCTTGAGGAGCAGGTAGCGGG + Intergenic
926033394 2:9613099-9613121 CAGGATAAGGAAGAGGTAGTAGG - Intronic
926266840 2:11330879-11330901 AGGAATGAGGAGGAGGGAGGAGG + Intronic
926275111 2:11397581-11397603 CAGGATGAGAAAGAAGTAGCTGG - Intergenic
926439755 2:12875459-12875481 GAGAATGAGGAGGTGGAGGCTGG + Intergenic
927357293 2:22187816-22187838 CAGAATTAGCGGGAGGTAGGGGG + Intergenic
927510581 2:23641603-23641625 CAGAATGAGGAAGATGTATTTGG - Intronic
927851738 2:26503862-26503884 CAGAATGAGGTGCAGGGAGAGGG + Intronic
928101390 2:28439567-28439589 CGGACTGAGGAGGAGGCAGAGGG + Intergenic
928724223 2:34152165-34152187 TAGGCTGAGGAGGAGGAAGCAGG - Intergenic
929325968 2:40611052-40611074 GAGAAAGAGGAGGAGGTGCCGGG + Intronic
929575067 2:43046352-43046374 CGGAAAGAGGAGGAGGAAACGGG + Intergenic
930392893 2:50784439-50784461 AAGAATGTGGAGGATGTTGCAGG + Intronic
932002181 2:67895229-67895251 CACAATGATGAGGAGTGAGCTGG - Intergenic
932072760 2:68637237-68637259 CAGATAGAGGAGGAGGTGGGAGG + Intergenic
932124644 2:69132747-69132769 AAGGATGGGGAGGAGGTTGCTGG + Intronic
932753341 2:74386960-74386982 CAGCTTGTGGAAGAGGTAGCAGG - Intronic
933496248 2:83053635-83053657 GAGAAAGAGGAGGAGGAAGAGGG + Intergenic
933651329 2:84852513-84852535 CAGAATGACCATGAGGTGGCAGG + Intronic
934574769 2:95392925-95392947 CAGGATGAGGAGGAAGGGGCTGG + Intergenic
934751898 2:96799201-96799223 CAGGATGAGGATGAAGTAGTCGG - Exonic
934845324 2:97658490-97658512 CAGCAGGAGTCGGAGGTAGCGGG + Exonic
935531667 2:104240368-104240390 GAGGATGAGGAGGAGGGAGGAGG + Intergenic
935798890 2:106672369-106672391 CAGAAGGGTGAGGAGGTAGGAGG - Intergenic
935847897 2:107187085-107187107 CTGAAGGAGGAGGAGGAAGCTGG + Intergenic
936121201 2:109746843-109746865 GAGAGAGAGGAGGAGGTACCAGG - Intergenic
936223495 2:110624628-110624650 GAGAGAGAGGAGGAGGTACCAGG + Intergenic
937217310 2:120321105-120321127 GAGAAGGAGGAGGAGGGAGAAGG - Intergenic
937217319 2:120321134-120321156 GAGAAGGAGGAGGAGGGAGAAGG - Intergenic
937217376 2:120321291-120321313 GAGAAGGAGGAGGAGGGAGGAGG - Intergenic
937217382 2:120321307-120321329 GAGAAGGAGGAGGAGGGAGAAGG - Intergenic
937217387 2:120321323-120321345 GAGAAGGAGGAGGAGGGAGAAGG - Intergenic
937573353 2:123390970-123390992 GAGAATGGGGAGGAGGAAGGAGG - Intergenic
937822459 2:126326287-126326309 CAGAATGAAGAGGAGGTAATGGG - Intergenic
938292619 2:130158176-130158198 CAGGATGAGGAGCAGGTGGGAGG - Intronic
938463934 2:131514795-131514817 CAGGATGAGGAGCAGGTGGAAGG + Intergenic
938673890 2:133611271-133611293 CAGATGGAGGAGGTGGTGGCGGG - Intergenic
938758686 2:134403851-134403873 CACCATGTGGTGGAGGTAGCCGG + Intronic
939211995 2:139187475-139187497 AAGAAAGAGGAGGACGTAGCAGG - Intergenic
939554687 2:143660235-143660257 CAGAATGTGGAGGAGGAAGGAGG - Intronic
941572302 2:167186693-167186715 CAGCATGAGGAAGAGCAAGCAGG - Intronic
942207729 2:173638195-173638217 AAGAAGGAGGAGGAGGCAGGAGG + Intergenic
942799093 2:179856334-179856356 CAGAAGGAGGAGCAGGTTGAGGG - Intronic
942866347 2:180680025-180680047 TAGGAGGAGGAGGAGGAAGCAGG - Intergenic
944160200 2:196651947-196651969 AAGAGAGAGGAGGAGGTACCAGG + Intronic
945021935 2:205582473-205582495 GAGAAGGATGAGGAAGTAGCTGG + Intronic
946029982 2:216695820-216695842 GAGAATGGGGAGGAGGTGGAGGG + Intergenic
946148554 2:217748927-217748949 CAGGAAGAGGAGGAGGCAGCAGG - Intronic
946296205 2:218785588-218785610 TAGGATGAGGAAGAGGAAGCAGG + Intronic
946598715 2:221335476-221335498 CAGCATAAGGAGACGGTAGCCGG - Intergenic
946899118 2:224355375-224355397 AAGAATGAGGAGGATGGAGGAGG - Intergenic
947970599 2:234319918-234319940 AAGAAGGAGGAGGAGGGAGGAGG - Intergenic
948029057 2:234801421-234801443 CAGTTTGAGGAGAAGGGAGCAGG - Intergenic
948878428 2:240842567-240842589 CAGAATGAGTCGGGGGGAGCAGG + Intergenic
948878439 2:240842622-240842644 CAGAATGAGTCGGGGGGAGCAGG + Intergenic
948878479 2:240842838-240842860 CAGAATGAGTCGGGGGGAGCAGG + Intergenic
948878498 2:240842947-240842969 CAGAATGAGTCGGGGGGAGCAGG + Intergenic
948878565 2:240843298-240843320 CAGAATGAGTCGGGGGGAGCAGG + Intergenic
1169043487 20:2516561-2516583 CAGAGTGAGGATGAGTGAGCAGG + Intronic
1169211677 20:3769165-3769187 CAGAAAGAGGCGGAGGAGGCAGG - Intergenic
1169325253 20:4670551-4670573 CAGGATGAGGAGGAGGAAGAGGG + Intergenic
1169448912 20:5694727-5694749 GAGCATGAGAAGGAGGTTGCTGG - Intergenic
1170158570 20:13290257-13290279 CAATATGAGGAGGAGGAAGAGGG + Intronic
1170495118 20:16916296-16916318 CAGAAGGGGGAGGAGGTGTCAGG + Intergenic
1170929056 20:20752240-20752262 CAGAATGGGGAGGAGGAAACAGG + Intergenic
1171255943 20:23689109-23689131 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171272356 20:23826800-23826822 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1173858290 20:46265307-46265329 GAGAAAGAGGAGGAGGAAGAGGG - Intronic
1174020325 20:47524817-47524839 GAGAATGAGGCAGAGGTTGCAGG - Intronic
1174174687 20:48637362-48637384 AGGAAGGGGGAGGAGGTAGCGGG - Intronic
1174407886 20:50313848-50313870 AAGAAGGAGGAGGAGGCACCTGG + Intergenic
1174547943 20:51340335-51340357 TAGAATGTGGATGAGATAGCTGG - Intergenic
1174641773 20:52050479-52050501 GAGAAAGAGGAGGAGGAAGGAGG - Intergenic
1174696659 20:52566109-52566131 CAGAATGAGGTGGAGCTAGCTGG + Intergenic
1174720644 20:52808427-52808449 GAGAAAGAGGAGGAGGAAGAGGG - Intergenic
1174896904 20:54459048-54459070 CAGAATGAGGAGGGGGGAAAAGG + Intergenic
1177168175 21:17626428-17626450 CAGAATTAGAAGGGGGTAGATGG + Intergenic
1177244780 21:18509461-18509483 CAGAACCAGGAGGAGGTAATCGG + Intergenic
1177386574 21:20417202-20417224 CAGAAAGGGAAGGAGGTAGGGGG - Intergenic
1178110682 21:29367104-29367126 CAGAAAGAGGAGGAGGTGCCAGG - Intronic
1179049336 21:37875386-37875408 AAGAAGGGGGAGGAGGAAGCAGG - Intronic
1179236741 21:39554167-39554189 CAGAATGACTAGGAGGAAGGAGG - Intergenic
1179303827 21:40136813-40136835 CAGAATGAGGAAGAGGAGCCTGG + Intronic
1179649311 21:42796529-42796551 AAGAATGAGGAAGAGGTCCCAGG - Intergenic
1179836176 21:44035055-44035077 CAGGTTGAGGAGGATGGAGCAGG + Intronic
1180097841 21:45568211-45568233 CAGAAGCAAGAGGAGGCAGCTGG + Intergenic
1180837004 22:18934906-18934928 CAATAGGAGGAGGAGGCAGCAGG - Intronic
1180856341 22:19048221-19048243 CAGAATGGGAAGGAGGCAGCTGG + Intronic
1180856433 22:19048767-19048789 TAGAATGGGAAGGAGGCAGCTGG + Intronic
1181064954 22:20301119-20301141 CAATAGGAGGAGGAGGCAGCAGG + Intergenic
1181112098 22:20608225-20608247 CAGAATGAGGAGCAGATGGAAGG - Intergenic
1181599577 22:23941557-23941579 CAGCAAGAGGAGGAGGTATCTGG - Intergenic
1181608930 22:23999749-23999771 CAGCAAGAGGAGGAGGTATCTGG + Intergenic
1181683744 22:24514479-24514501 CAGGATCAGGAGGAGGTGGAAGG + Intronic
1182304876 22:29360991-29361013 AAGAATGGGGAGGAGGGAGGAGG + Intronic
1182312189 22:29417126-29417148 AAGAATGGGGAGGAGGGAGGAGG + Intronic
1182353291 22:29710752-29710774 GAGATTCAGGAGGAGGAAGCGGG + Intergenic
1182688076 22:32136116-32136138 AAGAATGCGGAGGAGGGAGGAGG - Intergenic
1182843246 22:33409288-33409310 CGGAAGGAGGAGGAGGAGGCTGG + Intronic
1183007754 22:34917361-34917383 AAGAATGTGGAGGAGGAACCAGG + Intergenic
1183068521 22:35380341-35380363 CAGAGTGTGGAGGAGGCAGGCGG + Intronic
1183600176 22:38835487-38835509 GAGGATGAGGAAGAGGGAGCAGG + Intronic
1183756991 22:39776854-39776876 CAAAATGAAAAAGAGGTAGCAGG - Intronic
1183939131 22:41282926-41282948 GAGAATGAGGAGGTTGTAGGAGG - Intronic
1184098410 22:42329012-42329034 CAGAGTGAGGTGGAGGGTGCTGG - Intronic
1184111416 22:42397819-42397841 CTGAAAGAGGTGGAGGGAGCCGG + Intronic
1184946475 22:47807673-47807695 GAGAAGGAGGAGGAGGAAGAGGG + Intergenic
1185045251 22:48525443-48525465 CAGAAGGCGGAGCAGGTGGCAGG - Intronic
1203287097 22_KI270734v1_random:160205-160227 CAATAGGAGGAGGAGGCAGCAGG - Intergenic
949465460 3:4339090-4339112 CAGAATGAGGAGGGAGTAGTGGG - Intronic
949680388 3:6506773-6506795 CAGAATGAGAAAGTGGTAGTAGG - Intergenic
950665940 3:14494997-14495019 CAGAAGGAGGAGGAGGTTCCTGG + Intronic
952319415 3:32262069-32262091 CAGAAGGAAGACGAGGAAGCAGG + Intronic
952500758 3:33959659-33959681 GAGAGGGAGGAGGAGGAAGCAGG + Intergenic
952553847 3:34509479-34509501 GAGAAGGAGGAGGAGGAAGTGGG - Intergenic
953136328 3:40185453-40185475 GAGAAAGAGGAAGAGGGAGCAGG + Intronic
953879567 3:46684609-46684631 CAGAATGGGGAGGACGTGGGAGG + Intronic
953929047 3:46996898-46996920 CAGAGGGAGGAGGGGGTGGCAGG - Intronic
954121846 3:48504235-48504257 CAGGAGGAGGAGGAGGGAGGAGG + Exonic
954384448 3:50236908-50236930 CAGAAGGAGAAGGAGGGAGTGGG - Intronic
955068449 3:55552413-55552435 AAGAATGAGGGGGAGGAAGAAGG - Intronic
955148544 3:56344317-56344339 GAGAATGAGGAGGAGGAGGAGGG - Intronic
955216963 3:56992089-56992111 CAGGATGAGGATGAGAAAGCTGG - Intronic
955216970 3:56992167-56992189 CAGGATGAGGATGAGAAAGCTGG - Intronic
955984782 3:64561258-64561280 CAGAAGGAGGGGGAGATAGAAGG - Intronic
956166017 3:66398831-66398853 CATAATGAGAAGGAAGCAGCTGG + Intronic
956168137 3:66411926-66411948 GAGAATGAGGGGGTGGTGGCGGG + Intronic
956361090 3:68448144-68448166 CAAAATGAGGAGGAGTTCTCAGG + Intronic
956482664 3:69688609-69688631 GAGAAGGAGGAGGAGGAAGAGGG - Intergenic
956743082 3:72290058-72290080 AAGAATGAACAGGAGTTAGCAGG + Intergenic
957426780 3:80050721-80050743 CAGGAGGAGGAGGAGGTAGAAGG + Intergenic
957661101 3:83154913-83154935 AAGAAAGAGGAGGAGGTTCCAGG + Intergenic
959972818 3:112426404-112426426 AAGAAAGAGGAGGAGGTGCCAGG + Intergenic
960357747 3:116674351-116674373 CAGAAGGAGGTGGGGGTGGCTGG - Intronic
960444890 3:117735832-117735854 CAAAATGGGGAGGAGGTAGTAGG - Intergenic
960708224 3:120502183-120502205 CAGAATCAGGTGGCGGTGGCTGG - Intergenic
961001538 3:123377397-123377419 CAGGAAGAGTAGGAGGTAACTGG - Intronic
961348706 3:126284363-126284385 CAGAATGTGGAGGTGGAAGATGG - Intergenic
961491933 3:127262436-127262458 CAGACTGAGGAGGGGAGAGCAGG - Intergenic
961644716 3:128386753-128386775 GAGAGTGAGGAGGAGGTGCCAGG + Intronic
962383039 3:134912212-134912234 CACAAAGAGCAGGAGGCAGCAGG + Intronic
962383939 3:134917585-134917607 CAGAAGGAGGAGGATGTAGTGGG + Intronic
962684097 3:137829898-137829920 AAGAGAGAGGAGGAGGTACCAGG + Intergenic
962922421 3:139963088-139963110 GAGAATGAGGAGGAGGAGGGGGG + Intronic
963430323 3:145193261-145193283 AATAATGAGAAGGAGGTAGCAGG + Intergenic
964374438 3:156035601-156035623 AAGGAGGAGGAGGAGGAAGCAGG - Intergenic
964984391 3:162721609-162721631 AAGAATAAGGAGGGGGTAGAAGG + Intergenic
965302918 3:167025784-167025806 GAGAGAGAGGTGGAGGTAGCGGG - Intergenic
966099187 3:176245396-176245418 CAGAAGGAGGAGAAGGGAGATGG + Intergenic
968229260 3:196995670-196995692 CAGGAAGAGAAGGAGGGAGCAGG + Intronic
968978715 4:3835296-3835318 CAGGATGAGGTGGAGGTGACAGG + Intergenic
973096436 4:46207069-46207091 CAAAATGATGGGGAGGTAGGAGG + Intergenic
973612654 4:52651288-52651310 CAGAATGTGGAGGGAGTAGAAGG + Intronic
974571180 4:63650784-63650806 CCACATGAGGAGGAAGTAGCAGG + Intergenic
974743934 4:66045130-66045152 GAAAAGGAGGAGGAGGTAGCCGG + Intergenic
975834203 4:78404550-78404572 CAGAAGGAGGAGGGGGTTGGAGG - Intronic
975991805 4:80266157-80266179 CAGAGAGAGGACGAGATAGCAGG + Intergenic
978264747 4:106810305-106810327 AAGAAGGAGGAGGAGGAAGAAGG - Intergenic
978777248 4:112516252-112516274 CAGGAGGAGGAGGCGGTGGCGGG - Intergenic
979863440 4:125723372-125723394 CATCATGAGGAGGAAGTAACTGG + Intergenic
980463967 4:133150778-133150800 GAGAAGGAGGGGGAGGTGGCGGG + Exonic
980669482 4:135986075-135986097 GAGAAAGAGGAGAAGGTAGCTGG + Intergenic
980875268 4:138656035-138656057 AAGCATGAGGTGGAGGCAGCTGG - Intergenic
981006209 4:139878212-139878234 AAGAATGAGTAGGAGTTGGCGGG - Intronic
981245226 4:142528496-142528518 AAGAATGAGGAAGAGCTAGAGGG + Intronic
981431336 4:144664311-144664333 CAGCATGTGGAGGAGGATGCAGG + Intronic
981817098 4:148843097-148843119 CAGGAAGAGGAGAAGGAAGCAGG - Intergenic
982463738 4:155704495-155704517 CTGCATCAGGAGGAGGTAGAAGG + Intronic
983275006 4:165606140-165606162 CAGAAAGAGGAGGTGGAAGGAGG - Intergenic
984653545 4:182293722-182293744 AAGCATGTGGAGGAGGCAGCGGG - Intronic
986068499 5:4259420-4259442 CAGGAGGAGGAGGAGGTAAGAGG - Intergenic
986399605 5:7368210-7368232 GAGAGAGAGGAGGAGGTATCGGG - Intergenic
986429193 5:7664979-7665001 CAAAGTGAGGAGGAGGGGGCGGG - Intronic
990165832 5:52992293-52992315 CAGAATGAAGAGGAGGATTCAGG - Intronic
991436484 5:66601563-66601585 CAGGATGAGCAGGAGTTAGGTGG + Intronic
992473292 5:77077860-77077882 CAGAATGAGGAGTGGCGAGCCGG - Exonic
993985613 5:94593878-94593900 CCAAATGAGGAGAAGGGAGCAGG - Intronic
994088673 5:95788207-95788229 CAGAATGAGGAGAATGGAGCTGG + Intronic
994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG + Intergenic
995016789 5:107318878-107318900 AAGAAGGAGGAGGAGGAAGGAGG + Intergenic
996421864 5:123271204-123271226 CAGAAGTATGAGGAGGTATCAGG - Intergenic
996843722 5:127876728-127876750 CAAATGGAGGAGGAGGAAGCAGG + Intergenic
997221093 5:132165084-132165106 CAGAATAAGTAGGTGGTGGCGGG - Intergenic
998200149 5:140113016-140113038 CAGAAGGAGGAGGGGGAGGCGGG + Intronic
998537669 5:142949696-142949718 CAGAGTGGGAGGGAGGTAGCTGG + Intronic
998561039 5:143171779-143171801 CAAATTGAAGAGGTGGTAGCAGG + Intronic
1000199917 5:158997994-158998016 CAGAATGAGGAGGAGGTAGCAGG - Intronic
1000975367 5:167758493-167758515 CACAATGACAAGGAGGAAGCTGG - Intronic
1001115047 5:168932454-168932476 CAGAAAGACTAGGAGGTAGGAGG + Intronic
1001132908 5:169079552-169079574 AAGAAGGAGGAGGAGGAAGGAGG + Intronic
1001179420 5:169505297-169505319 CAGATAGAGGAGGAGGTTACTGG + Intergenic
1001184582 5:169556646-169556668 GAGAAGGAGGAAGAGGTGGCAGG - Intergenic
1001417505 5:171556159-171556181 CAGAAAGAGGAGGAAGTAAAGGG - Intergenic
1001543707 5:172557107-172557129 CAGAAGCAGGAGGAGGGAGGGGG - Intergenic
1001784052 5:174396602-174396624 CAGGATGAGGAGGAACTAACGGG + Intergenic
1001902189 5:175441877-175441899 CTGAAAAAGGAGGAGGCAGCTGG - Exonic
1002581221 5:180210419-180210441 CAGAGTGAGGTGAAGGCAGCTGG - Intergenic
1002836335 6:868386-868408 AAGAATGAGGAGGAAGTTACAGG - Intergenic
1003113878 6:3270503-3270525 CAGCCTGAGGAGGAGGAGGCCGG - Exonic
1003128572 6:3376227-3376249 AAGAAGGAGGAGGAGGCAGCTGG - Intronic
1003197310 6:3926248-3926270 CAGCAGGAGGAGGAGAAAGCAGG + Intergenic
1003227083 6:4215725-4215747 AAGAAAGAGGAGGAGGTGCCAGG - Intergenic
1003318508 6:5032901-5032923 CAGCAGGAGGAGGAGAAAGCAGG - Intergenic
1003392264 6:5724285-5724307 CAGGATGAAGAGGAGCTAGCAGG + Intronic
1003523671 6:6880897-6880919 TAGAATGTGGATGTGGTAGCTGG - Intergenic
1003903996 6:10681986-10682008 AAGAATGAGGAGGAGTCACCAGG + Intronic
1004157997 6:13187640-13187662 CAGAAAGAGGAGCAGGTTGAAGG + Intronic
1004193927 6:13487518-13487540 CAGAATGAGGAGGCTGGCGCCGG - Exonic
1004459324 6:15820842-15820864 CAGAATGGAGAGGAGAGAGCTGG - Intergenic
1006609743 6:35287147-35287169 CAGAATGAGCAGGAGGAAACTGG + Intronic
1006715571 6:36117398-36117420 AGGAATGAGGAGGAGGAAGAGGG - Intergenic
1007927635 6:45663201-45663223 CAGGAAGAGGAGGAGGGAGATGG - Intronic
1007969200 6:46033607-46033629 CAGAATGAGGAAGGGCTGGCAGG - Intronic
1008016420 6:46525596-46525618 CAGACTGAGGATGAGGAAGAAGG + Intergenic
1008541991 6:52553554-52553576 TAGAATGGGGAGGAGGAAGGAGG - Intronic
1010752497 6:79631241-79631263 GAGAGGGAGGAGGAGGGAGCCGG - Intergenic
1011480672 6:87790592-87790614 CTGAATGTGGAGGGGTTAGCAGG + Intergenic
1011735463 6:90305983-90306005 CAGAATGAGTAGGAGTTTGCTGG - Intergenic
1012366544 6:98447551-98447573 CTGGGTGAGGAGGAGGTAGAAGG - Intergenic
1012615072 6:101267655-101267677 ATGAATGAGGAGGAGTTATCTGG + Intergenic
1013912636 6:115296160-115296182 CAGAATGAAGACCAGGTAGATGG + Intergenic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1015143184 6:129958375-129958397 GGGAGTGAGGAGGAGGTAGGAGG + Intergenic
1015405652 6:132834306-132834328 CAGAAAGAGGATGAGGGAGGAGG + Intergenic
1015625955 6:135181323-135181345 GAGAAGGAGGAGGAGGAAACAGG - Exonic
1015702950 6:136056087-136056109 TAGAAGGAGGAGGAGGAATCTGG + Intronic
1016168915 6:140983812-140983834 GAGAATGAGGAAGAGGTTGCAGG - Intergenic
1016562508 6:145412880-145412902 CAGAATGAGGGGAAGGCATCTGG + Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1016989257 6:149918223-149918245 GAGGATGAGGAGGAGGCTGCAGG + Exonic
1017462964 6:154668401-154668423 AAGAAAGAGGAGGAGGAAGGAGG + Intergenic
1018791044 6:167147983-167148005 AAGAGGGAGGAGGAGGAAGCAGG - Intronic
1018850820 6:167589078-167589100 CTGAAGGAGGAGGATGGAGCAGG - Intergenic
1019562828 7:1666631-1666653 CAGAAAGAGGGGGAGGGGGCTGG + Intergenic
1019570885 7:1711502-1711524 CAGAAAGAGGAGGAGACAGCCGG + Intronic
1019702213 7:2479508-2479530 AAGAATGAGTAGGAGTTAGAAGG + Intergenic
1019831644 7:3336457-3336479 CACAATGAGGTGGTGCTAGCAGG + Intronic
1019907455 7:4075425-4075447 CAGAATGAGGAGGAAGTTTCAGG + Intronic
1019919565 7:4154835-4154857 CAGAATTGGGAGGAGTTAGAAGG + Intronic
1021755042 7:23843435-23843457 CAGAATTAGGGAGAGGTCGCAGG - Intergenic
1021934928 7:25620895-25620917 CAGAATAAGGTGGTGGTGGCTGG - Intergenic
1021960526 7:25868297-25868319 CAAACTGAGGAGGAGGAAGTGGG - Intergenic
1021986818 7:26105340-26105362 AAGAAGGAGGATGAGGAAGCTGG - Intergenic
1023149128 7:37183193-37183215 CAGAAGGAGAAGGAGGAAGGAGG + Intronic
1023349809 7:39309127-39309149 CAGAACGAGGGGGAGGGAGTCGG + Intronic
1023558141 7:41444815-41444837 CAAAATGAGGAGAAGGTGCCAGG - Intergenic
1023814638 7:43940274-43940296 CAGAGTGATGAGCAGGTACCAGG - Intronic
1023966733 7:44966789-44966811 CCCAATGAGGACAAGGTAGCTGG - Exonic
1024116352 7:46197412-46197434 CTGACTGAGGAGGTGGGAGCAGG - Intergenic
1024237482 7:47409205-47409227 AGGAAGGAGGAGGAGGTAGCTGG + Intronic
1024846258 7:53646189-53646211 AAGAAGGAGGAGGAGGAAGGAGG - Intergenic
1024964151 7:55006622-55006644 CAGGCTGAGGAGGAGGTCGCTGG + Intergenic
1025887753 7:65614429-65614451 AAGAAGGAGGAGGAGGAAGAAGG - Intergenic
1025945393 7:66100450-66100472 AAGAATGAGGAGGAGGAAAGAGG + Intronic
1026123995 7:67563389-67563411 CAGAATGAGGTGGAAGTGGTAGG - Intergenic
1026191907 7:68136496-68136518 GAGAAGGAGGAGGAGGGAGGAGG + Intergenic
1026199314 7:68200496-68200518 CAGCATGAGGTAGAGATAGCGGG - Intergenic
1026905065 7:74058096-74058118 GAGAAGGAGGAGGAGGGAGAAGG - Intronic
1027464898 7:78503425-78503447 CAGAACCAGGTGGAGGTAACTGG + Intronic
1028084475 7:86619232-86619254 CAGTATGTGGAAGAGGTATCTGG - Intergenic
1028086096 7:86639639-86639661 GAGGATGAGGATGAGGAAGCCGG - Intergenic
1028120723 7:87053815-87053837 AAGGATGAGTAGGAGTTAGCTGG - Intronic
1029058122 7:97768081-97768103 CAGGCAGAGGAGGTGGTAGCTGG + Intergenic
1029094963 7:98077827-98077849 GAGAAAGAGGAGCAGGTACCAGG - Intergenic
1029198838 7:98825445-98825467 GAGAGTGAGGAGGAGGTGCCAGG - Intergenic
1029271525 7:99379939-99379961 CAGAGAGAGGAGGGGATAGCCGG - Intronic
1030107017 7:105996045-105996067 CAGAATGAGAAGCAGCCAGCGGG + Intronic
1030317582 7:108132278-108132300 GAGAATGAGGAGGAGGGATCTGG - Intergenic
1030835394 7:114277769-114277791 CAGAAAGAGGCGGAGGTGGATGG + Intronic
1031959732 7:127977917-127977939 CTGGAAGAGGAGGAGGTAGGTGG + Intronic
1032090492 7:128909297-128909319 CAGAGAGAGGAGGAGGGAGAGGG + Intronic
1032285279 7:130534872-130534894 GAGGAAGAGGAGGAAGTAGCGGG + Intronic
1032312759 7:130803575-130803597 CAGCAGGAGGAGGAGGATGCTGG + Intergenic
1033045527 7:137958777-137958799 CAGAATGAGGAAGTGTTAGCTGG - Intronic
1033099802 7:138460471-138460493 CAGGAGGAGGAGGAGGTCGTCGG + Exonic
1033305358 7:140221561-140221583 CAGAGTGAGCAGGAAGTTGCTGG - Intergenic
1033378744 7:140791236-140791258 CAGTAAGAGGAGAAGGCAGCAGG - Intronic
1033608940 7:142947167-142947189 CAGGGACAGGAGGAGGTAGCTGG + Intronic
1034248608 7:149670042-149670064 AAGGAGGAGGAGGAGGGAGCAGG - Intergenic
1034271196 7:149804117-149804139 CAGAATTGGGAGGAGGAAGGGGG - Intergenic
1034380460 7:150687875-150687897 GAGAGTGAGGAGGAGGGAGTGGG - Intronic
1035120495 7:156562811-156562833 CAGAATGAGGAAGAGGAAATTGG + Intergenic
1036557852 8:9875794-9875816 CAAAATGAGGAAGAGGTGGCTGG + Intergenic
1036601051 8:10260408-10260430 GAGACAGAGGAGGAGGAAGCGGG + Intronic
1037041694 8:14244258-14244280 AAGAATGAGGAAGAGGAAGAAGG - Intronic
1037147638 8:15592529-15592551 GAGAGTTAGGAGGAGGTGGCAGG - Intronic
1037187230 8:16078717-16078739 GAGAATGATGAGGAGGCAGTTGG + Intergenic
1037272048 8:17141102-17141124 CAGAATGGGCACGAGGTATCGGG + Intergenic
1037465835 8:19159295-19159317 CAAAATGTGGAGGATTTAGCAGG + Intergenic
1037645269 8:20787286-20787308 TAGGATGAGGAGGAGGTGACAGG - Intergenic
1037716812 8:21407904-21407926 CAGAGTGGGGAGGAGGAAGGTGG - Intergenic
1038780989 8:30568400-30568422 CAGAGTGAGGGGCAGGCAGCGGG + Intronic
1039171171 8:34747213-34747235 AAAAATGAGGAGAAGGTAGTGGG + Intergenic
1039339701 8:36634138-36634160 CAGAATGCAGAGGAGGAAGCTGG - Intergenic
1040370143 8:46762310-46762332 CAGGCAGAGGAGGTGGTAGCTGG - Intergenic
1040770551 8:50970132-50970154 CAGAATGAGAAGGGGGAAGGGGG + Intergenic
1041313469 8:56539163-56539185 CAGAATGGGGAGGAGGAGGGAGG + Intergenic
1041317519 8:56579780-56579802 AAGAATGAGGAGGAGAAAGAAGG + Intergenic
1041392677 8:57360621-57360643 GAGAAGGAGGAAGAGGGAGCAGG - Intergenic
1041479446 8:58302592-58302614 GAGAAGGAGGAGGAGGTGGAGGG + Intergenic
1041669139 8:60475524-60475546 GAGAAAGAGGAGGAGAAAGCAGG - Intergenic
1043161523 8:76853086-76853108 CAGAAGGTGGAGGAGGTGGGGGG - Exonic
1044775397 8:95681707-95681729 AAGAATGAGCAGGAGTTAGGGGG + Intergenic
1045163990 8:99582307-99582329 CAGAATGAGGTGAGGGTATCAGG - Intronic
1045420264 8:102007733-102007755 CAGAGGGAGGAGGAAGTAGAAGG - Intronic
1045557797 8:103231513-103231535 CAGAATGAGGAGGTAATGGCTGG + Intergenic
1045773773 8:105776986-105777008 CAGAATCAGAAAGAGGAAGCAGG - Intronic
1045811608 8:106227303-106227325 AAGAATGAGCAGGAGTTAGCTGG - Intergenic
1048489790 8:134882016-134882038 CTGAACGAAGAGGAGGCAGCTGG + Intergenic
1048980097 8:139698622-139698644 TTGAGTGAGGAGGAGGGAGCTGG - Intronic
1049659306 8:143812630-143812652 CAGAAGGCTGAGGAGGCAGCTGG - Intronic
1049820367 8:144629763-144629785 CAGGAAGAGGAGGAGGGCGCTGG + Intergenic
1049825064 8:144662744-144662766 GATAATGGGGAGGAGGGAGCTGG - Intergenic
1052043775 9:23770917-23770939 CAGAATGACAAGGAGATAACAGG + Intronic
1053024708 9:34720066-34720088 CACTAGGAGGAGGAGGTGGCAGG - Intergenic
1053375212 9:37600374-37600396 CAGAATAAATAGGAGGTGGCCGG - Intronic
1053449140 9:38178987-38179009 TGGAATGAGGAGGAGGTGGAAGG - Intergenic
1055180311 9:73379270-73379292 AAGAGAGAGGAGGAGGTATCAGG - Intergenic
1055298150 9:74854572-74854594 GAGAAGAAGGAGGAGGTTGCTGG - Intronic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1055862182 9:80764977-80764999 CAGGTTAAGGAGTAGGTAGCAGG - Intergenic
1057255199 9:93540751-93540773 CAGAGTGAAGAGGAGGTCACAGG - Intronic
1057276418 9:93678122-93678144 CAGAAAGAGGAGGAGCAAGTGGG + Exonic
1058561444 9:106233184-106233206 AGGAATGAGGAGGAGGAAGAAGG - Intergenic
1058561475 9:106233343-106233365 AAGAAGGAGGAGGAGGAAGAGGG - Intergenic
1058906122 9:109484028-109484050 CAGAGTGAAGAGGAGGAAGTTGG - Intronic
1059179681 9:112200101-112200123 TAGAATGAGTAGGAGGCAGTTGG + Intergenic
1060406805 9:123376899-123376921 CAGGAGGAGGAGGAGGAGGCAGG - Exonic
1060730156 9:126031779-126031801 CAGAAAGAGGAGGGGGAAGAGGG + Intergenic
1061264614 9:129497763-129497785 AAGAATGACAAGGGGGTAGCGGG + Intergenic
1061605622 9:131708474-131708496 CAGCTTGAGGAGGAGGAAGTTGG - Intronic
1061619663 9:131803647-131803669 CAGAGGTAGGAGGAGGGAGCAGG + Intergenic
1061755967 9:132812813-132812835 CAGAATGAGGTGGATGTAGGAGG - Intronic
1062451926 9:136619375-136619397 CTGAAGGAGGAGGAGGAAGAGGG + Intergenic
1062697669 9:137883799-137883821 CAGATGGAAGAGGAGGGAGCAGG + Intronic
1185662080 X:1735757-1735779 GAGAAAGAGGAGGAGGGAGGAGG - Intergenic
1186276158 X:7940253-7940275 CAGATTCATGGGGAGGTAGCTGG - Intergenic
1187025742 X:15433912-15433934 AAGAAGGAGGAGGAGGAAGGAGG + Intronic
1187338931 X:18404294-18404316 TAAGAAGAGGAGGAGGTAGCAGG - Intergenic
1187717230 X:22114751-22114773 GAGAGTGAGGATGAGTTAGCAGG + Intronic
1187746641 X:22416321-22416343 AAGAGAGAGGAGGAGGTACCAGG - Intergenic
1189406204 X:40726543-40726565 CAGAAAGAAGAGGAGATAGCTGG - Intronic
1189590465 X:42505777-42505799 CAGAATGAGGATGGAGTAGAAGG + Intergenic
1189911287 X:45812849-45812871 CAGAAAGAAGAGGAGGGAGGAGG + Intergenic
1190463152 X:50698907-50698929 CAGAGTTAGGAGGAGGAAGGTGG - Intronic
1190719996 X:53139839-53139861 AAGAAGGAGGAGGAGGCAGGAGG + Intergenic
1190777867 X:53568619-53568641 ACGAATGATGTGGAGGTAGCTGG - Intronic
1190915391 X:54808266-54808288 AGGAATGAGGAGCAGGGAGCGGG + Intronic
1192079611 X:68033836-68033858 GAGAAAGAGGAGGAGGTGCCAGG - Intergenic
1192496055 X:71617277-71617299 CAGAAAGAGGAGGCTGTAGAGGG + Exonic
1192611756 X:72573699-72573721 CAGAAACAAGAGGAGGTAGGAGG - Intergenic
1193102979 X:77636807-77636829 AAGGAGGAGGAGGAGGAAGCAGG + Intronic
1194538925 X:95146177-95146199 CAGAAGCTGGAGGAGGTATCTGG + Intergenic
1195004339 X:100671406-100671428 CAGGATGAGGGGTGGGTAGCAGG + Intergenic
1198011523 X:132561024-132561046 CAGAATGAGGTGGAAGGAGCAGG - Intergenic
1198510306 X:137343850-137343872 GAGAAAGAGGAGGTAGTAGCAGG - Intergenic
1199201508 X:145095217-145095239 CAGACTTAGGAAGAGGAAGCAGG - Intergenic
1199502813 X:148527746-148527768 TAGAATGAGGATGAGGTGGCGGG - Intronic