ID: 1000200124

View in Genome Browser
Species Human (GRCh38)
Location 5:159001014-159001036
Sequence CTATATATATTTATGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000200121_1000200124 -8 Left 1000200121 5:159000999-159001021 CCTCTTTTTTTCCAACTATATAT 0: 1
1: 0
2: 8
3: 73
4: 687
Right 1000200124 5:159001014-159001036 CTATATATATTTATGAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000200124 Original CRISPR CTATATATATTTATGAAGCT GGG Intronic
No off target data available for this crispr