ID: 1000201638

View in Genome Browser
Species Human (GRCh38)
Location 5:159016638-159016660
Sequence TGGCATTGCAGTCATAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 197}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000201638_1000201645 7 Left 1000201638 5:159016638-159016660 CCATGCCTATGACTGCAATGCCA 0: 1
1: 0
2: 0
3: 7
4: 197
Right 1000201645 5:159016668-159016690 GGGTCATCATTACTGGCACTTGG No data
1000201638_1000201644 0 Left 1000201638 5:159016638-159016660 CCATGCCTATGACTGCAATGCCA 0: 1
1: 0
2: 0
3: 7
4: 197
Right 1000201644 5:159016661-159016683 GGTGTCAGGGTCATCATTACTGG 0: 1
1: 0
2: 0
3: 9
4: 75
1000201638_1000201647 13 Left 1000201638 5:159016638-159016660 CCATGCCTATGACTGCAATGCCA 0: 1
1: 0
2: 0
3: 7
4: 197
Right 1000201647 5:159016674-159016696 TCATTACTGGCACTTGGGTGAGG No data
1000201638_1000201648 21 Left 1000201638 5:159016638-159016660 CCATGCCTATGACTGCAATGCCA 0: 1
1: 0
2: 0
3: 7
4: 197
Right 1000201648 5:159016682-159016704 GGCACTTGGGTGAGGACAGCTGG 0: 1
1: 0
2: 1
3: 26
4: 322
1000201638_1000201649 22 Left 1000201638 5:159016638-159016660 CCATGCCTATGACTGCAATGCCA 0: 1
1: 0
2: 0
3: 7
4: 197
Right 1000201649 5:159016683-159016705 GCACTTGGGTGAGGACAGCTGGG No data
1000201638_1000201646 8 Left 1000201638 5:159016638-159016660 CCATGCCTATGACTGCAATGCCA 0: 1
1: 0
2: 0
3: 7
4: 197
Right 1000201646 5:159016669-159016691 GGTCATCATTACTGGCACTTGGG 0: 1
1: 0
2: 0
3: 9
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000201638 Original CRISPR TGGCATTGCAGTCATAGGCA TGG (reversed) Intronic
905278377 1:36833596-36833618 TGGCATTGCAGACAGAGGTTGGG + Intronic
906604679 1:47159182-47159204 TATCATTCCAGACATAGGCATGG + Intergenic
906607611 1:47182746-47182768 TGGGAGGGCAGGCATAGGCAAGG + Intergenic
908637622 1:66185909-66185931 TGCCATTCAAGACATAGGCATGG - Intronic
908921793 1:69203188-69203210 TGGCTTTGCAGTCATGGGGCAGG + Intergenic
908937201 1:69390522-69390544 TACCATTCCAGACATAGGCATGG - Intergenic
909024637 1:70468244-70468266 TGCCATTGCAGTCAGAGCCTTGG + Intergenic
909211951 1:72835331-72835353 TGGCATTCAGGACATAGGCATGG + Intergenic
913695668 1:121322978-121323000 TCGCTTTGCAGTTATAGGCTTGG + Intronic
914141901 1:144957081-144957103 TCGCTTTGCAGTTATAGGCTTGG - Intronic
916145904 1:161739166-161739188 TCGCAGTGCTGTCATAGGCCAGG - Intergenic
918786808 1:188773945-188773967 TGGCATTCAGGGCATAGGCATGG + Intergenic
920183142 1:204144828-204144850 TGGCATGGCAGAAATAAGCAGGG - Intronic
920444115 1:206002740-206002762 TGGCATTGCAGCACTGGGCAAGG + Intronic
920482993 1:206341360-206341382 TCGCTTTGCAGTTATAGGCTTGG + Intronic
922432575 1:225570485-225570507 TGGCCTTGCTGTCTTAGGAAGGG - Intronic
923100307 1:230809111-230809133 TCTCCTTGCAGTCACAGGCATGG + Intergenic
924673176 1:246149009-246149031 TGGCAATGCAGTTAGAGACAAGG + Intronic
1063139075 10:3240682-3240704 TGGCAGTGCAGTGAGAGGAAAGG + Intergenic
1063851865 10:10201220-10201242 TGGGAATGCAGTCATAGGTGGGG + Intergenic
1064855474 10:19762571-19762593 TGGCAATGGATTCTTAGGCATGG - Intronic
1065755060 10:28923524-28923546 CCGCATTGCAGTCACAGCCAAGG + Intergenic
1066001995 10:31113249-31113271 TGGCAATGCAGTCAGGGGCCTGG - Intergenic
1067822801 10:49544933-49544955 TGCCATTCCAGTCAAAGGCTTGG + Intergenic
1071925872 10:90408587-90408609 TGGGAGTGCATTCAGAGGCAAGG + Intergenic
1072534689 10:96353263-96353285 TGGCATTTCAGTCCTCAGCAGGG + Intronic
1073845623 10:107550541-107550563 TATCATTCCAGACATAGGCATGG + Intergenic
1077721304 11:4632035-4632057 TACCATTCCAGACATAGGCATGG + Intergenic
1083572324 11:63767387-63767409 TGGCTTCGGAGTCATAGGCCTGG + Intronic
1083836383 11:65271482-65271504 TGGGATTTCAGTCATTGGAAGGG - Intronic
1086021263 11:82232686-82232708 TGGCACTGCAGTCATGGGAGTGG - Intergenic
1087381887 11:97415317-97415339 TGCCATTGTAGACATAGTCATGG - Intergenic
1088696743 11:112372744-112372766 TGCCATTCAAGACATAGGCATGG - Intergenic
1092809019 12:12254646-12254668 TGGCATTCCAGTCAAAGCCTTGG - Intronic
1093854260 12:24080303-24080325 TAGCATTGCAATCATAGAAATGG - Intergenic
1094579465 12:31721101-31721123 TGGCTTTGCACTGTTAGGCAAGG - Intronic
1094730505 12:33169143-33169165 TGCCATTGAGGACATAGGCATGG + Intergenic
1095526407 12:43130948-43130970 TCACATTGCAGTCCCAGGCAGGG - Intergenic
1102462511 12:113108751-113108773 TGGCTGTGCAGACTTAGGCAAGG - Intronic
1108893969 13:55299544-55299566 TGACATTTTAATCATAGGCAAGG + Intergenic
1113046804 13:106164954-106164976 TACCATTTGAGTCATAGGCATGG - Intergenic
1114011415 14:18373093-18373115 TGCCATTGAGGACATAGGCATGG + Intergenic
1114682356 14:24496472-24496494 TACCATTCCAGACATAGGCATGG + Intergenic
1115832596 14:37358907-37358929 TACCATTCCAGACATAGGCATGG - Intronic
1116250649 14:42478895-42478917 TAGCATAGCAGTAATAGGGAAGG - Intergenic
1116928224 14:50663497-50663519 TGGAAATGCAGTAAGAGGCATGG - Intronic
1120312195 14:82843380-82843402 TGTCATTGAAGTTACAGGCATGG - Intergenic
1121154483 14:91670273-91670295 TGGCATGATAGTCATAAGCATGG - Intronic
1122016010 14:98797196-98797218 TGCCATTACATTCTTAGGCAGGG + Intergenic
1123008770 14:105337221-105337243 AGTCATTGCATTCATAGGGACGG + Intronic
1127662202 15:61110588-61110610 AGGCATTGCTGTTATAGGCGAGG + Intronic
1129733261 15:77943966-77943988 TTGAATTGGAGTCATAGTCAAGG - Intergenic
1129959871 15:79674584-79674606 TGGCATTGAAGCCTTAGGAATGG - Intergenic
1130768990 15:86905340-86905362 TCACATTGCACTAATAGGCAAGG + Intronic
1130802163 15:87276391-87276413 TGCCATTGAGGACATAGGCATGG - Intergenic
1130907593 15:88251526-88251548 TTGCACAGAAGTCATAGGCATGG - Intronic
1131064090 15:89422224-89422246 TGGCATTCCCAGCATAGGCAAGG + Intergenic
1132785162 16:1652910-1652932 TGGCCTTGCAAACAGAGGCAAGG - Intronic
1133495496 16:6313402-6313424 TGGCATTGCATTCATTGCCTGGG + Intronic
1134386380 16:13777335-13777357 TGGAATTACAGGCATAGGCTTGG - Intergenic
1135774522 16:25244985-25245007 TGGGAATCCAGTCATAGGCCTGG - Intronic
1135924354 16:26679489-26679511 TGACGTTGCAGTCACTGGCAAGG - Intergenic
1138369121 16:56510579-56510601 TGGGATTTCAGTCATATTCACGG - Intronic
1143118426 17:4593288-4593310 TGACATGGCAGGCAGAGGCAGGG - Intronic
1143258759 17:5583416-5583438 TGGCATTGTAGTTATGAGCACGG - Intronic
1144956271 17:19020362-19020384 TGGCATTGAAGCCACAGACACGG - Exonic
1145861692 17:28216606-28216628 TGGCATTGCATTCAGGGTCATGG + Intergenic
1148791471 17:50175604-50175626 TGGCATTGGGGTCATAGCCCTGG - Intronic
1150287799 17:63963753-63963775 TGCCATTGCAGTCTTTGCCATGG + Exonic
1153545645 18:6202576-6202598 GGGGACTGCAGTCATAGGAATGG + Intronic
1156941863 18:42777355-42777377 TGGCATTTAAGTCATAGTCCTGG + Intronic
1158281933 18:55838061-55838083 TGGAATTGTAGTCACAGGGAAGG - Intergenic
1161576493 19:5057362-5057384 TGGCAGTGCACTCATTGTCATGG + Intronic
1164730541 19:30500810-30500832 TGGGATTGGTGTCAGAGGCAAGG + Intronic
1164761544 19:30731961-30731983 TGTCATTTCAGTCCTGGGCAAGG + Intergenic
1165309785 19:35023016-35023038 TGGCATGGCAGTCAAGGGTATGG + Intronic
1166886585 19:45964939-45964961 TGGCTTTGCAGGCATGGGGAAGG + Intronic
925115006 2:1371263-1371285 TGGCACTGCTGTGATACGCAGGG - Intergenic
925548503 2:5043300-5043322 TGGCATTGCTTTCTCAGGCAAGG + Intergenic
926422559 2:12714713-12714735 TGGCATTTCAGGCAGAGGGAAGG - Intergenic
926473106 2:13285961-13285983 AGGCTTCACAGTCATAGGCAAGG + Intergenic
927020862 2:19015619-19015641 TGCCATTGAGGACATAGGCATGG - Intergenic
927635714 2:24814969-24814991 TGGGATTACAGGCATAAGCAAGG - Intronic
927867870 2:26603726-26603748 TGGGATTACAGGCATAAGCATGG - Intronic
929695819 2:44114355-44114377 TGGCAAAGCAGGCAAAGGCATGG - Intergenic
931135829 2:59399481-59399503 TGGCATTGCAGACATGGGGTTGG - Intergenic
932278264 2:70467906-70467928 GGGCTTTGCAGTCAGAGGCACGG + Intronic
932781070 2:74558809-74558831 TGGGACAGGAGTCATAGGCAGGG + Exonic
933597454 2:84296391-84296413 CGGTATTGCACCCATAGGCAGGG + Intergenic
935621470 2:105134070-105134092 TGGCACTGCAGTCACAGTCAGGG + Intergenic
935657450 2:105436990-105437012 TGGGAATGCAGTGAGAGGCATGG + Intronic
938064209 2:128272288-128272310 TGGCATTCCAGTGAAGGGCATGG - Intronic
938069610 2:128301373-128301395 TGTCATTGCAGACACAGGAAGGG - Intronic
941050855 2:160732044-160732066 TAGTATTGCAGGCAAAGGCAAGG + Intergenic
941259155 2:163274389-163274411 TGGCTTTTCTGTCCTAGGCATGG + Intergenic
942193643 2:173495736-173495758 TGCCATTGGAGTCACAGCCAGGG + Intergenic
942700407 2:178701535-178701557 TGGCACTGCTCTGATAGGCATGG + Exonic
946913757 2:224493455-224493477 AGGCTTTGGAGCCATAGGCATGG + Intronic
947902390 2:233732364-233732386 TGGCCTAGAAGACATAGGCATGG - Intronic
948716945 2:239871343-239871365 TGGCAAAGCAGTCAGAAGCATGG - Intergenic
1169031775 20:2415114-2415136 TGGCATTACATTCTTTGGCAGGG + Intronic
1170217412 20:13906143-13906165 TGGCATTACAGGCATAAGCCAGG + Intronic
1171052219 20:21870678-21870700 TTGCTTTGCAGTCAGGGGCAGGG + Intergenic
1171076188 20:22126670-22126692 TGGCATTGTAGTCATCTGAAAGG - Intergenic
1171267023 20:23780009-23780031 TAGCATTGAGGACATAGGCATGG - Intergenic
1172312540 20:33929729-33929751 GGGTCTTGCAGACATAGGCAGGG - Intergenic
1174142803 20:48428299-48428321 TGTCAAAGCAGTCATAGGGAAGG - Intergenic
1178019588 21:28394024-28394046 GGGCTTTGCAGACATAGGCGAGG + Intergenic
1180435909 22:15303897-15303919 TGCCATTGAGGACATAGGCATGG + Intergenic
1181582000 22:23833746-23833768 TGGCTTTCCAGGCAGAGGCAGGG + Intronic
949361276 3:3234624-3234646 TGGCATTCCAGTCAAAGCCTTGG - Intergenic
949524690 3:4891585-4891607 TGGCAAAGCAGTCATAGCCTGGG - Intergenic
951833050 3:26951475-26951497 TGGGATTCCACTCATAAGCAAGG - Intergenic
955181369 3:56673942-56673964 TGGCATTACATACATAGACAAGG + Intronic
958077177 3:88695584-88695606 TAGCCTTGAGGTCATAGGCATGG + Intergenic
958683269 3:97357949-97357971 TGGTCTTGCTGTCTTAGGCATGG + Intronic
962404667 3:135090679-135090701 TGGCACTGCAGACATGGGCATGG - Intronic
968625293 4:1624160-1624182 TGGCATTGTGGGCATGGGCATGG + Intronic
970698150 4:18702126-18702148 TACCATTGAAGACATAGGCATGG - Intergenic
970920640 4:21390376-21390398 TACCATTGAAGACATAGGCATGG - Intronic
972216051 4:36897806-36897828 TTGCATTGCAATGAAAGGCATGG + Intergenic
972691287 4:41401105-41401127 TAGCATTCAAGACATAGGCATGG - Intronic
972905755 4:43745037-43745059 TACCATTCCAGACATAGGCATGG + Intergenic
973329158 4:48895061-48895083 TGACTTTACAGTCATAGGAAGGG + Intronic
973632622 4:52833627-52833649 TGGCATTGCAGTGATAGAGATGG - Intergenic
974769110 4:66387645-66387667 TGGCATTCAGGACATAGGCATGG + Intergenic
975474678 4:74809770-74809792 TACCATTCAAGTCATAGGCATGG + Intergenic
977061909 4:92270358-92270380 TTGCATTGCAGTCATAGGTTGGG + Intergenic
979169153 4:117577735-117577757 TGGCATGGCAGACATAGGCCAGG - Intergenic
980446765 4:132920361-132920383 TGCTCTTGCTGTCATAGGCATGG + Intergenic
980853035 4:138406511-138406533 TGGAATTGAAGTCATCTGCAAGG - Intergenic
981366468 4:143909842-143909864 TGGAAATGCAGTAAGAGGCATGG - Intergenic
982461488 4:155674710-155674732 AGGCATTGTATTCATAGGCGAGG - Intronic
982612917 4:157599500-157599522 GAGCATTGCAAACATAGGCAAGG + Intergenic
983260203 4:165447936-165447958 TGGGATTGCAGTCATATGTGGGG + Intronic
984340054 4:178445881-178445903 TGCCATTGAGGACATAGGCACGG - Intergenic
986183199 5:5413298-5413320 TACCATTCCAGACATAGGCATGG + Intergenic
988141936 5:27254320-27254342 TGGGAGTTCACTCATAGGCATGG + Intergenic
988971738 5:36475365-36475387 TGCCATTCCGGACATAGGCATGG + Intergenic
989942037 5:50163007-50163029 TACCATTGAGGTCATAGGCATGG + Intergenic
991276973 5:64860131-64860153 TGGCATAGCAGTTAAATGCATGG - Intronic
993423587 5:87733616-87733638 TGGCAGTGCAGAGATTGGCAGGG + Intergenic
994137495 5:96304523-96304545 TAGCATTCAAGACATAGGCATGG - Intergenic
994277818 5:97860089-97860111 TGCCATTCAAGACATAGGCAGGG + Intergenic
994307917 5:98229011-98229033 TACCATTGAAGACATAGGCATGG + Intergenic
995816187 5:116170903-116170925 TGCCATTCAAGACATAGGCATGG + Intronic
996782452 5:127202207-127202229 TGCCATTGAGGACATAGGCATGG + Intergenic
998836671 5:146208468-146208490 TGGCAATGCAGTAAAAGGGAGGG + Intronic
1000129607 5:158283503-158283525 TAGCATTACATTCATAGTCAGGG + Intergenic
1000201638 5:159016638-159016660 TGGCATTGCAGTCATAGGCATGG - Intronic
1000423979 5:161069250-161069272 TACCATTCCAGACATAGGCATGG - Intergenic
1002242509 5:177853399-177853421 TGCCATTGCACTCCTAGGCCTGG - Intergenic
1005809196 6:29503326-29503348 TGGCTTTGCAGTTATGAGCATGG + Intergenic
1005842160 6:29750824-29750846 TGGCAGTGGAGGCATAGGCCTGG + Intergenic
1006983759 6:38164731-38164753 TGGCAATGCAGCCCAAGGCAGGG - Intergenic
1008675238 6:53812029-53812051 GGGCATTGCATGCACAGGCAGGG + Intronic
1012887614 6:104863200-104863222 TGCCATTCCAGTCAAAGGCCAGG + Intergenic
1015276793 6:131390566-131390588 CTGCATTCCAGTCATAGGGAAGG + Intergenic
1015332672 6:131998745-131998767 TGGCATTGACGTCATAGCCGCGG + Intergenic
1015840189 6:137468418-137468440 AGGCATTGCTATCATAGGAAAGG + Intergenic
1016453629 6:144209522-144209544 TGCCATTGCAGTCAGAGCCTTGG - Intergenic
1019488052 7:1298496-1298518 TGGCATTGCAGCCTCAGGCTGGG + Intergenic
1020158664 7:5750148-5750170 TGGCATTCCAGTCAAAGCCTTGG - Intronic
1020856105 7:13425980-13426002 TAGTATTGCAGTCTTAGCCAGGG + Intergenic
1021644096 7:22770995-22771017 TAGAATTGCAATCATAGGCTGGG - Intergenic
1021881605 7:25100378-25100400 TGGCTTTTTAGTCAAAGGCAGGG + Intergenic
1022781997 7:33595110-33595132 TAGCATTCAAGACATAGGCATGG + Intronic
1023568702 7:41550655-41550677 TGCCATTCCGGACATAGGCATGG - Intergenic
1023628659 7:42141336-42141358 TGGCATTTCACTCATAGACTTGG - Intronic
1024893645 7:54231204-54231226 TACCATTCCGGTCATAGGCATGG - Intergenic
1024900273 7:54311182-54311204 TACCATTCCGGTCATAGGCATGG + Intergenic
1028316313 7:89406993-89407015 TACCATTGAAGACATAGGCATGG - Intergenic
1028342512 7:89739155-89739177 TTCAATTGCAGTCATAGGCCCGG + Intergenic
1028362379 7:89984700-89984722 TACCATTGAAGACATAGGCATGG - Intergenic
1029162092 7:98559784-98559806 TGGCTTGGCCGTCACAGGCATGG + Intergenic
1029404028 7:100362776-100362798 TGGCATTGCAGGCTGAGCCACGG + Intronic
1029923208 7:104287878-104287900 TGGAATTACAGGCATAAGCATGG + Intergenic
1034743491 7:153500451-153500473 TAGCATTCAAGACATAGGCATGG - Intergenic
1037920056 8:22799486-22799508 TAAAATTGCAGTCATTGGCAGGG + Intronic
1039092143 8:33843678-33843700 TGGCATGGCTGGGATAGGCATGG + Intergenic
1039239782 8:35544051-35544073 TGTCAGTGCAGCCTTAGGCAAGG + Intronic
1039695755 8:39909207-39909229 TGGCATTTCAGTCAAAGCCTTGG - Intronic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1045885020 8:107085638-107085660 TGGCTTTTCAGTCAGAGGAAGGG - Intergenic
1048853305 8:138664590-138664612 TGGACTTTCAGTCTTAGGCAGGG - Intronic
1051492442 9:17681620-17681642 TGCCATTCAAGACATAGGCATGG + Intronic
1052408116 9:28088351-28088373 GGGCATAGCAGTCTTAGCCATGG - Intronic
1056442057 9:86631439-86631461 TGGGATTCCAGGCATAAGCAAGG - Intergenic
1057388097 9:94622021-94622043 TGGCCTGGGAGTCATAGGCAGGG - Intronic
1061642871 9:131973329-131973351 TGGCATCCCAGTCATTGCCAAGG - Intronic
1187285907 X:17903354-17903376 TGGAATTGGACTCAAAGGCAAGG - Intergenic
1191225684 X:58040544-58040566 TGCCATTGCAGTCAGAGCCTTGG + Intergenic
1191939148 X:66458898-66458920 TGCCATTGAGATCATAGGCATGG + Intergenic
1191948734 X:66564869-66564891 TGCCATTGAGATCATAGGCATGG - Intergenic
1192587318 X:72329263-72329285 TGGCACTGCAGTCATGGAGAGGG - Intergenic
1194323514 X:92481201-92481223 TGTCATTGCAGTCAGAGCCTTGG - Intronic
1194990402 X:100541240-100541262 TGCCATTCAGGTCATAGGCATGG - Intergenic
1196123526 X:112075748-112075770 TGGCTTTGAAGTCAGAGGAATGG + Intronic
1196985879 X:121270207-121270229 TAGCATTCAAGACATAGGCATGG + Intergenic
1197274243 X:124459659-124459681 TACCATTCCAGACATAGGCATGG + Intronic
1197378893 X:125714080-125714102 TGCCATTGCAGTCAGAGCCTTGG + Intergenic
1198128784 X:133673632-133673654 TGGCCTTGGAGTCAGAGACATGG + Intronic
1199259348 X:145752948-145752970 TGGCATTGCAGTGACATCCAAGG - Intergenic
1200631616 Y:5594367-5594389 TGTCATTGCAGTCAGAGCCTTGG - Intronic
1201628070 Y:16037043-16037065 TGACATTGCAGTCATCTCCATGG - Intergenic