ID: 1000202208

View in Genome Browser
Species Human (GRCh38)
Location 5:159022371-159022393
Sequence TTCTGACACTAGGCATATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000202201_1000202208 16 Left 1000202201 5:159022332-159022354 CCCACAGGATGTGCGCTGACTGA 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1000202208 5:159022371-159022393 TTCTGACACTAGGCATATGGAGG No data
1000202204_1000202208 -7 Left 1000202204 5:159022355-159022377 CCAGCTGGCTTCCAAGTTCTGAC 0: 1
1: 0
2: 0
3: 28
4: 325
Right 1000202208 5:159022371-159022393 TTCTGACACTAGGCATATGGAGG No data
1000202202_1000202208 15 Left 1000202202 5:159022333-159022355 CCACAGGATGTGCGCTGACTGAC 0: 1
1: 0
2: 1
3: 5
4: 54
Right 1000202208 5:159022371-159022393 TTCTGACACTAGGCATATGGAGG No data
1000202200_1000202208 22 Left 1000202200 5:159022326-159022348 CCGCTTCCCACAGGATGTGCGCT 0: 1
1: 0
2: 2
3: 14
4: 153
Right 1000202208 5:159022371-159022393 TTCTGACACTAGGCATATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000202208 Original CRISPR TTCTGACACTAGGCATATGG AGG Intronic
No off target data available for this crispr