ID: 1000202341

View in Genome Browser
Species Human (GRCh38)
Location 5:159023882-159023904
Sequence GGGCAAACAGGAGGAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 706
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 647}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000202332_1000202341 9 Left 1000202332 5:159023850-159023872 CCTAAGTTGAATGTGGAGTTGGA 0: 1
1: 0
2: 0
3: 11
4: 186
Right 1000202341 5:159023882-159023904 GGGCAAACAGGAGGAGTGGAAGG 0: 1
1: 0
2: 5
3: 53
4: 647

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000202341 Original CRISPR GGGCAAACAGGAGGAGTGGA AGG Intronic
900532743 1:3162730-3162752 TGCCACACAGGAGGACTGGAGGG - Intronic
900592264 1:3465377-3465399 AGGCAGACAGGAGGAGAGGACGG + Intronic
900704834 1:4073949-4073971 GGGCTCACAGGAGGACTGGCAGG - Intergenic
901130933 1:6962378-6962400 GGGCCCAGAGGGGGAGTGGAAGG - Intronic
901556181 1:10033013-10033035 GGGGAAAGAGTAGGGGTGGAGGG + Intronic
901871585 1:12141757-12141779 GGGCCACCAGGCGGAGTGGGTGG + Intronic
902717173 1:18280833-18280855 GGGCAGACAGGAGGAGATCATGG - Intronic
902970575 1:20045201-20045223 GGAGAAACAGGAGGAATGGAGGG + Intronic
903316487 1:22511959-22511981 GAGCAAACAGGTGCAGTGTAAGG + Exonic
903509976 1:23867833-23867855 CGGCAAACAGGAGGTGGGGCTGG - Intronic
904567058 1:31434438-31434460 GGGCAACAGGGAGGAGGGGAAGG - Exonic
904971985 1:34426450-34426472 GGGCACACAGGAGGAGGGTCAGG + Intergenic
905004001 1:34695846-34695868 GAGTGAACAGGAGGATTGGAGGG - Intergenic
905254588 1:36672010-36672032 GGGCACTCTGGAGGGGTGGAAGG - Intergenic
905734424 1:40315982-40316004 GGGCAAACTGGCACAGTGGAAGG - Intronic
906197580 1:43938530-43938552 AGGCACACAGGCGGATTGGAAGG - Intergenic
906518679 1:46454503-46454525 GGAGAAACAGGAGGAGAGGCTGG - Intergenic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907575709 1:55523910-55523932 AGACAAACAAGAGGAGTGAAGGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907893009 1:58653631-58653653 GGGGAACGAGGAAGAGTGGAGGG - Intergenic
908577153 1:65472305-65472327 GGGAAAACGGGTGGAGTGGATGG + Intronic
908723227 1:67148228-67148250 CGGCAATCAGCAGTAGTGGACGG + Intronic
909919314 1:81360743-81360765 GGGAAAAAAGGAAGAGAGGAAGG + Intronic
910118881 1:83762042-83762064 GAGTGAACAGGAGGTGTGGAGGG - Intergenic
911144360 1:94538489-94538511 GGGAAAACAGGCAGAGAGGAAGG + Intronic
911713911 1:101108958-101108980 GGGAAAACAGGAGAAGTAGCAGG - Intergenic
912061374 1:105675178-105675200 GGGCAAACAGGGGAAATGGCAGG + Intergenic
913572196 1:120131808-120131830 GGGGCAACAGGGAGAGTGGATGG + Intergenic
914293116 1:146293452-146293474 GGGGCAACAGGGAGAGTGGATGG + Intergenic
914554160 1:148744235-148744257 GGGGCAACAGGGAGAGTGGATGG + Intergenic
914918312 1:151831548-151831570 GGAGAAACAGGAGGAGGGGCTGG - Intronic
914956990 1:152171797-152171819 GAGCAAAGAGGAGGGATGGAGGG + Intergenic
915214474 1:154330663-154330685 GGGGAAAGAGGAGGAGAGAAGGG - Intronic
915218537 1:154355856-154355878 GGGCAGGCAGGAGGTGAGGAGGG + Intergenic
915319329 1:155047662-155047684 GGGCAGGCAGGAGGAGAGCAGGG + Intronic
916206348 1:162319499-162319521 GGGCATACAGAAGGACTGGTGGG - Intronic
916474809 1:165158998-165159020 GGCCAGTCAGGAGGAGTGGGAGG + Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
918130244 1:181621224-181621246 GGGCAATCAGGAGGTATAGAAGG + Intronic
918665432 1:187145240-187145262 GGATAAATAGGAGGAGCGGAGGG - Intergenic
918668874 1:187187585-187187607 GGGAAAGCAGGAGGAGGGAAAGG + Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919827663 1:201515022-201515044 GGGCAGACAGGAGGCTGGGATGG + Intergenic
920053277 1:203175905-203175927 GGTCAAGCAGGAGGACTGGAGGG + Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921007515 1:211109275-211109297 GGGCAGCCAGGAAGAGTGGCAGG + Intronic
921160426 1:212468471-212468493 GGGAAGACAAGAGGAGGGGAGGG - Intergenic
922446375 1:225701304-225701326 GTGCAAAAAAGAGGAGTGGGTGG + Intergenic
922709447 1:227815984-227816006 GGGGACACAGGAGGAAGGGAAGG - Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923052113 1:230396253-230396275 GGGTAAAAAGGAGGAGTGTGGGG - Intronic
923275068 1:232388358-232388380 GGAGAAAGAGGAGGAGGGGAAGG + Intergenic
923873209 1:238018930-238018952 GGGAAAAGAGCAGGAGTGCAGGG + Intergenic
924918247 1:248596949-248596971 GGGAAAAAAGGAGGAAAGGAAGG + Intergenic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1065365337 10:24929822-24929844 GGAAAAACAGGAGGATTTGAGGG - Intronic
1065458896 10:25934833-25934855 GTGGAAACAGGAGGAGGGAACGG + Intronic
1065744107 10:28823116-28823138 GAGGAAACAGGGGGACTGGAAGG - Intergenic
1066254109 10:33662101-33662123 GGGGAGACAGGAGGAAGGGACGG - Intergenic
1066437506 10:35407707-35407729 GGAGAAGAAGGAGGAGTGGAGGG + Intronic
1067281539 10:44877081-44877103 GGGGATACAGGGGGAGTGAAAGG - Intergenic
1067661025 10:48236312-48236334 GGGAAAACAGCAGCAGTGGGAGG + Intronic
1067935997 10:50612470-50612492 TGGCGAAAAGGAGGAGTGGAGGG + Intronic
1068680698 10:59816962-59816984 GGGCAAAAAGGAGGAGGTGCAGG + Intronic
1068756386 10:60658949-60658971 AGGCAGGCAGGAGGAGAGGAAGG + Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068933678 10:62616316-62616338 GTGCAAAGAGGAGGATTTGAAGG + Intronic
1069178450 10:65325388-65325410 GGAGAGACAGGAGGAGAGGAAGG - Intergenic
1069717832 10:70532296-70532318 GAGCACACAGGAGGCCTGGAGGG - Intronic
1070334280 10:75440427-75440449 GGGCAGGGATGAGGAGTGGAGGG + Intronic
1070549062 10:77476329-77476351 GGGCCATCAGGAGGGGTGGGAGG - Intronic
1070662376 10:78316560-78316582 GGGCAGATGGGAGCAGTGGATGG - Intergenic
1070722430 10:78765840-78765862 GGGCAGAAAGGAGGAGGCGATGG + Intergenic
1070956195 10:80465108-80465130 GGGCAAGGAGCAGGAGTGGCCGG + Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072401900 10:95111256-95111278 GGGCAAGCTGGAGGAGGGCAGGG - Intergenic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072547872 10:96454439-96454461 AGGCATGCAGGAGGAGAGGAGGG - Intronic
1073326731 10:102647592-102647614 GGCCAAACAGGGGGAGTGGGTGG + Intronic
1073467994 10:103705277-103705299 TGGCAAACAGGGGGAGGGAAGGG + Intronic
1073587800 10:104727427-104727449 GGACAAACAGAAGGATAGGAAGG - Intronic
1074045353 10:109832899-109832921 GGCCAAACAGGGTGTGTGGATGG + Intergenic
1074341987 10:112641245-112641267 GGGCCTGCAGGAGGACTGGAAGG - Intronic
1075248558 10:120846134-120846156 GGACAAGAAGGAGGAATGGAAGG - Intergenic
1075650729 10:124127157-124127179 GGGCATACTGGGTGAGTGGAAGG - Intergenic
1075651034 10:124128463-124128485 GTGCTAACAGGAGGAGCGGCTGG - Intergenic
1075762130 10:124864831-124864853 GGGCCAACAGGAGGAGAGAGAGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077166107 11:1139703-1139725 GGGCCAGCAGGAGGAAGGGAAGG + Intergenic
1077218792 11:1406117-1406139 GGCCAGGCAGGAGGAGGGGAAGG - Intronic
1078617989 11:12882623-12882645 GGGCAAACACAAGAAGTGCATGG + Intronic
1078899024 11:15624007-15624029 GGACAAGCAGGAAGGGTGGAGGG + Intergenic
1079169704 11:18081147-18081169 GGGACCACAGGAGGAGGGGAGGG - Intronic
1079238872 11:18708377-18708399 GGGCATAAAGGAGGAGAGGTTGG - Intronic
1079597640 11:22270558-22270580 TGGCAAAAAAGATGAGTGGAGGG + Intronic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1080289283 11:30652786-30652808 GGCAAAAGAGGATGAGTGGATGG + Intergenic
1083069549 11:59962538-59962560 TGGGAGAAAGGAGGAGTGGAGGG + Intergenic
1083778506 11:64906296-64906318 AGGCTAGCAGGAGGGGTGGATGG + Intronic
1084296411 11:68215371-68215393 GGGCAGACAGGAGAAGTGCTTGG - Intergenic
1084572880 11:69970135-69970157 AGACAAACAGGAAGAGAGGAAGG + Intergenic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1084945030 11:72633757-72633779 GGGCAAAGAAGAGGAAGGGAGGG + Intronic
1085412788 11:76301507-76301529 GGGCAGCCTAGAGGAGTGGAAGG - Intergenic
1085462404 11:76702039-76702061 GGGCAGAGTGGAGGAGTGGCAGG + Intergenic
1085532681 11:77201247-77201269 GGGCAATGAGGAGCCGTGGAAGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1086133008 11:83420361-83420383 GGAGAAGGAGGAGGAGTGGAGGG - Intergenic
1086777263 11:90853979-90854001 GAGCAAACAGAAGGGCTGGATGG - Intergenic
1087263716 11:96039310-96039332 GGGGAGAGAGGAGGAGAGGAGGG + Intronic
1088505402 11:110522295-110522317 AGGGAGACAGGAGGAGAGGAGGG - Intergenic
1090115053 11:123961463-123961485 AAGCAAAGAGGAGGAGTGTAAGG + Intergenic
1090137014 11:124209622-124209644 GGCCAAACTGGAGCAGAGGATGG - Intergenic
1090250329 11:125246505-125246527 GGGCAAACCGGGGAAGGGGAAGG - Intronic
1090441904 11:126731225-126731247 GGACTAACAGGAGAAATGGAAGG - Intronic
1090475204 11:127013971-127013993 GGGAATACAGGAGGAGGGGGAGG - Intergenic
1090859882 11:130643321-130643343 GGGCAGGGAGGAGGAGTGGTGGG + Intergenic
1090885533 11:130872895-130872917 GGACAAACAGCCGGTGTGGAGGG + Intergenic
1090927098 11:131258940-131258962 GGAGAAAAAGGAGGAATGGAGGG + Intergenic
1090954861 11:131504808-131504830 GTGCATGCAGGAGGAGTGGAGGG - Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093919205 12:24840519-24840541 GTACAAACAGCAGGAATGGAAGG + Intronic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1096022914 12:48337126-48337148 GAGCAAAGAGCAGGAATGGAGGG + Intergenic
1096263706 12:50107996-50108018 CAGAAAACAGGATGAGTGGATGG - Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1097176018 12:57143355-57143377 GGGTCAACAGGAAGAGGGGATGG - Intronic
1097314878 12:58161188-58161210 GGGCAAACATGAGAAATGCATGG + Intergenic
1097403633 12:59161057-59161079 TGGCAAAAAGGTGAAGTGGAAGG + Intergenic
1097803578 12:63941200-63941222 GCGCAAACAGTAGGAGAGAAAGG - Intronic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098251897 12:68579030-68579052 GGAGAAACAGAAGGAGGGGAGGG - Intergenic
1100980085 12:100156866-100156888 GGGCACGCAGGAGCAGGGGAGGG - Intergenic
1101751079 12:107582824-107582846 GGGCAATGAGCAGGAGTGGTGGG - Intronic
1103037396 12:117667494-117667516 GTGTGAACAGGAGGGGTGGAAGG + Exonic
1104088044 12:125493677-125493699 GGGCAGGCAGGAGGAGGGGGAGG + Intronic
1104776879 12:131394829-131394851 GGCCAAGCAGGAGGTGTGGGGGG - Intergenic
1104948207 12:132426865-132426887 GAGTAAACCGCAGGAGTGGAGGG - Intergenic
1106339357 13:28814363-28814385 AGGCAAACACAAGGAGTAGACGG - Intergenic
1107692838 13:42969139-42969161 GGCCAACCTGGAGAAGTGGAAGG - Exonic
1108301996 13:49087461-49087483 GGGAAAACAGGAAGAGAGAATGG - Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109767591 13:66924882-66924904 GGGCAAACTGGAACACTGGAAGG + Intronic
1110650661 13:77938136-77938158 GGAGAAGCAGGAGGAATGGAGGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111383603 13:87494321-87494343 GGGGAAACAATAGGAGTGGCTGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1112578255 13:100656429-100656451 GGGCACACAGGAGGTCTGCACGG + Exonic
1113350947 13:109528753-109528775 GGCCAAACAGGTGGAGGGGCAGG - Intergenic
1113534720 13:111056598-111056620 TGGCAAATAGCAGCAGTGGATGG - Intergenic
1113603841 13:111590609-111590631 GGACGGACAGGTGGAGTGGACGG + Intronic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114398755 14:22390081-22390103 GGGCACACAGCAGAAGGGGAGGG + Intergenic
1114634093 14:24177780-24177802 GGGCAAAGAGGAGGAGGAGGAGG - Intronic
1115815886 14:37164016-37164038 GGGCAAAAGGGAGGTGAGGAAGG + Intronic
1115862067 14:37698566-37698588 GGCCTAACTGGAGGAGTGAAAGG - Intronic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117412286 14:55461374-55461396 GGGCATGCAGAGGGAGTGGAGGG - Intergenic
1117772715 14:59151041-59151063 GGGTAAATATGAGGAGTGAAGGG + Intergenic
1118171725 14:63395538-63395560 GGGAAGAGAGGAGGAGAGGAGGG + Intronic
1118171730 14:63395558-63395580 GGGAAGAGAGGAGGAGAGGAGGG + Intronic
1118289188 14:64504452-64504474 GTGCAAACAGGAGGAGGAGGAGG + Intronic
1118329024 14:64801500-64801522 GGTCAGGCAGGAGGAGTGAAAGG + Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119614696 14:76091446-76091468 GGGCAGGAAGGAGGACTGGAGGG - Intergenic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1120564071 14:86032762-86032784 GAGCAAACAGGAGAAGGGGGAGG + Intergenic
1121100173 14:91244962-91244984 GGGGATACAGGAGGAGGGGGTGG + Intronic
1121289213 14:92760760-92760782 GGGGAAAAAGAAGGAATGGAGGG - Intergenic
1121684664 14:95826815-95826837 GGGCAAGCATCAGGAGTGGTTGG + Intergenic
1121703505 14:95974214-95974236 GGGAGAAAAGGAGGAATGGAAGG - Intergenic
1122126448 14:99581115-99581137 AAGCAAAGAGGAGGAGTGGGAGG + Intronic
1122371558 14:101231805-101231827 AGGAATACAGGAGGAGGGGAAGG - Intergenic
1122476729 14:102015287-102015309 GGGCAAAGAGGATGAGGGGGAGG + Exonic
1122601843 14:102925449-102925471 CGGGAAACAGGAGGAGGGCAGGG + Intronic
1122647892 14:103207273-103207295 GAGAAAAGAGGAGGAGGGGAGGG - Intergenic
1122914866 14:104854226-104854248 CGGCAGTCAGGAGCAGTGGAGGG + Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123681660 15:22768407-22768429 GGGGAAGCAGGAGGAGCAGATGG - Intergenic
1124018454 15:25898387-25898409 AGGCAAAGAGCAGGAGTGGTGGG + Intergenic
1124333911 15:28843101-28843123 GGGGAAGCAGGAGGAGCAGATGG - Intergenic
1124359422 15:29024856-29024878 AGGAACACAGGAGGAGCGGATGG + Intronic
1124618443 15:31259867-31259889 GGGAAAGAAGGAGGAGGGGAGGG + Intergenic
1125223659 15:37369333-37369355 GGGCAAAAAGATGGGGTGGAGGG + Intergenic
1125737784 15:41940156-41940178 GGGAAAGGAGGAGCAGTGGAGGG + Intronic
1126104537 15:45138947-45138969 GAGCAAACAGCAGGACTGGGTGG + Intronic
1126393495 15:48185780-48185802 GAGGAAAAAGGAGGAGTGAATGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127074522 15:55312237-55312259 CGGCAAACAACAGGGGTGGACGG + Intronic
1127846865 15:62877844-62877866 GGGCTAAAAGGAGGAGTCAAAGG + Intergenic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128582637 15:68819927-68819949 GGAGAAAGAGGAGGAGAGGAAGG + Intronic
1129005228 15:72367265-72367287 GGGAAAATAGTAGGAGAGGAAGG - Intronic
1129188563 15:73924840-73924862 GGGCAAGCAGGAGGGAGGGAAGG + Intergenic
1129234345 15:74214717-74214739 GGGCAAGCAGGTGGTGAGGAGGG - Intergenic
1129463322 15:75710707-75710729 GGGCATCCAGGAGGGGTGGGAGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130300982 15:82679916-82679938 GGGAAGACTTGAGGAGTGGAGGG - Intronic
1131244116 15:90775134-90775156 GTGGAAACAGCAGAAGTGGAAGG + Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132398633 15:101491195-101491217 GGGAGAACAGGAGGCGTGGTGGG + Intronic
1133073426 16:3262041-3262063 AGGCACGGAGGAGGAGTGGATGG + Intergenic
1133304695 16:4801790-4801812 GGGCACACAGGAGGTGTTCAGGG - Intronic
1133387642 16:5383197-5383219 GGGGAAACAGGAGGAGTAGGGGG + Intergenic
1133874773 16:9723350-9723372 GGGAGAACAGGAGGAGGAGAAGG + Intergenic
1134802691 16:17100032-17100054 GGGCAAAAAGGAGGTATGGCTGG - Intergenic
1135214339 16:20551804-20551826 GGGAAAACTGGAGTATTGGAGGG - Intronic
1135714022 16:24745403-24745425 GGGAAAAGAGGAAGACTGGAAGG + Intronic
1136072596 16:27796983-27797005 TGGCACACAGCAGGAGTGGGAGG - Intronic
1136178509 16:28535038-28535060 GGGCAAACAGGAAGTGTGGTTGG - Intronic
1136451647 16:30357229-30357251 GGACTAACTGGAGGGGTGGAAGG + Exonic
1137055531 16:35744758-35744780 GGGGAAGAAGGAGGAATGGAGGG + Intergenic
1137566723 16:49537978-49538000 GGGCAGACAGGAGGGCTGGCTGG - Intronic
1138401983 16:56754025-56754047 GGGCGTACAGGAAGCGTGGATGG + Intronic
1138411491 16:56843979-56844001 GGAGAAACAGGAGGAATGAAAGG + Intronic
1138527290 16:57616447-57616469 GGGCACATAGGAGGTGTGGAGGG - Intronic
1139039375 16:62983596-62983618 GGAGAAAAAGGAGGAATGGAGGG + Intergenic
1139196236 16:64921619-64921641 GGGGAAGGAGGAGGAGGGGAAGG - Intergenic
1139196266 16:64921790-64921812 GGGGAAGGAGGAGGAGGGGAAGG - Intergenic
1139636938 16:68263858-68263880 GAGCAAACAGAGGGAGGGGAAGG + Intergenic
1139910140 16:70392625-70392647 GGACAAATAGGAGGAGTGAGTGG + Intronic
1140199619 16:72884622-72884644 GAGAAAACAGGAGGAGGAGAAGG + Intronic
1140945897 16:79768200-79768222 GGGCAAACAGAGGGAGTGGAGGG + Intergenic
1141444592 16:84049853-84049875 GGGCCCACAGCAGGAGTGGCCGG + Intergenic
1141608149 16:85167230-85167252 GGGCAGACAGGAGCAGGGGACGG + Intergenic
1141609747 16:85174647-85174669 GGACACACATGAGGAGTGGAGGG + Intronic
1141705410 16:85661851-85661873 AGGCAAAAAGCAGGAGTGGACGG - Intronic
1141774570 16:86114237-86114259 GGGAAAAGAGGAAGGGTGGAGGG + Intergenic
1142209961 16:88804158-88804180 GGGGAAACAGGCGGGGGGGACGG + Intronic
1142551384 17:742184-742206 GGGCAGGCAGGAGGCATGGATGG + Exonic
1143096519 17:4481211-4481233 GGGCAAGCAGGAGGAGAGAGGGG + Intronic
1143172787 17:4939772-4939794 GGGAAAAGAGGAGGAAGGGAAGG - Intronic
1144378262 17:14667179-14667201 GGGCTATCAGGTGGACTGGAGGG + Intergenic
1145226103 17:21129341-21129363 GAGCTAACAGGAGGAGGGAAGGG + Intronic
1145780650 17:27560761-27560783 GGGCCGACAGGAGGAGGGGTGGG - Intronic
1146172735 17:30646019-30646041 GGGCAAAGAGGAGGGTAGGAAGG + Intergenic
1146187186 17:30731726-30731748 GGGAAGGCAGGAGGAGAGGAGGG - Intergenic
1146346193 17:32062028-32062050 GGGCAAAGAGGAGGGTAGGAAGG + Intergenic
1146370806 17:32264959-32264981 AGGAAAGCAAGAGGAGTGGAAGG + Intergenic
1147149686 17:38507457-38507479 GGGCCAGCAGGAGCAATGGACGG - Intronic
1147757748 17:42780006-42780028 TGGCAAACAGAAGGGGAGGAAGG + Intergenic
1148239366 17:45989971-45989993 GGGCACACAGCAGGGCTGGAGGG - Exonic
1148244714 17:46023054-46023076 TGGCAAACAGGAGGAATGTGTGG + Intronic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1150125556 17:62632418-62632440 GAGAAATCAGGAGGAGTGGGAGG - Intronic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151558477 17:74859053-74859075 GGGCAGAATGGAGGGGTGGAGGG - Intronic
1151669641 17:75565016-75565038 GGGCAGACAGGAGGTGTGGCTGG - Intronic
1151765623 17:76131979-76132001 GGGCAAACAGCAGCATTGGGAGG + Intergenic
1152002337 17:77654594-77654616 GAGCAGACAGGAGGGGTGGGAGG - Intergenic
1152044676 17:77928122-77928144 GGGCAGACAGGAGGCCTGGATGG + Intergenic
1152217706 17:79044061-79044083 GGGGGAACAGCAGGAGTGGGAGG + Exonic
1152687163 17:81700409-81700431 GGGCAACAGGGAGGAGAGGAAGG - Intronic
1152775909 17:82201878-82201900 TCGCAAGGAGGAGGAGTGGAGGG - Exonic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153926470 18:9839307-9839329 GGGCAAACAGGGGAAGAGTAAGG + Intronic
1154160339 18:11976680-11976702 GGGGAAGCTGGAGAAGTGGATGG + Intergenic
1154275325 18:12954324-12954346 TGGCCAACAGGAGGGGTGTAAGG + Intronic
1154343889 18:13526859-13526881 GGGAAGAGAGGAGGAGAGGAGGG - Intronic
1155713643 18:28912530-28912552 GTGCAAACAGGTTGAGTGAATGG + Intergenic
1156167860 18:34444682-34444704 GGGAAAAAAGAAGGATTGGATGG + Intergenic
1156493806 18:37512611-37512633 GGACAAAGAGGAGGAGGAGAAGG - Intronic
1157090152 18:44627378-44627400 CGTCAAAAAGGGGGAGTGGATGG + Intergenic
1157139082 18:45087610-45087632 GGGCAAAGAGGATGAATGGATGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157332916 18:46716525-46716547 TGGCAAAGAGGAGGTGTGGAAGG - Intronic
1157396318 18:47344732-47344754 GAGTATACAGGAGGAGTTGATGG - Intergenic
1157422695 18:47559611-47559633 GGGGAGACAGGAGAAGGGGAAGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158516911 18:58138365-58138387 GAGGAAAGAGGAGGAGGGGAGGG - Intronic
1159463360 18:68748404-68748426 GAGCAAACAGGATGAGTGCTAGG + Intronic
1159501349 18:69274818-69274840 GAGCAAAAAGGAGGTTTGGAAGG + Intergenic
1159833130 18:73303080-73303102 GAGCAAAGAGAAGGAGTGGCAGG - Intergenic
1160673324 19:376701-376723 GGGCACACAGGGGGAGAGGCTGG - Intergenic
1160825333 19:1077680-1077702 GGAAAAACAGGAGGAGTGGCCGG - Intronic
1160948784 19:1655808-1655830 GCGCACACAGTAGGTGTGGAGGG - Intergenic
1161319882 19:3636248-3636270 GGGCAGACAGGGGAAGTGGGGGG + Intronic
1161417089 19:4153502-4153524 GGGCAGGCAGGAGCAGGGGAGGG - Intergenic
1161518353 19:4709810-4709832 GGGCCAACAGGAGGGGTGGGAGG + Intronic
1161712420 19:5856553-5856575 GGGCAGACAGTAGGTGTGAAAGG - Intergenic
1161777802 19:6273252-6273274 AGGCAACCAGAAGGAGTGGCTGG + Intronic
1162174352 19:8820251-8820273 GGGCATATACTAGGAGTGGAAGG - Intronic
1162379371 19:10322725-10322747 GGGCACCCAGGAGGCCTGGAGGG + Exonic
1162989696 19:14294068-14294090 GGGCAAAGAGGAGGGTAGGAAGG - Intergenic
1163020069 19:14477055-14477077 GGGCCACCAGGAAGAGGGGAAGG - Intergenic
1163023195 19:14494926-14494948 TGGCCAGCAGGAGGAGGGGAAGG + Intronic
1163167085 19:15506013-15506035 GGGCAGAGAAGAGGAGGGGAGGG - Intergenic
1163242043 19:16070306-16070328 GAGCAGACAGGAGCAGTGGGTGG + Intronic
1163337445 19:16682531-16682553 GGACATACAGGAGGCATGGAGGG - Intronic
1163779676 19:19239792-19239814 GAGAAAAGAGGAGGAGTGGAAGG - Intronic
1164084207 19:21886871-21886893 GGGGAAACAGGATGAGGGGCTGG - Intergenic
1164441957 19:28285315-28285337 GGGGAAAGAGGTGGAGGGGAAGG + Intergenic
1164472463 19:28547580-28547602 GGGCAAGCAGGAGGGGTCCAGGG - Intergenic
1164555339 19:29246798-29246820 GGCAAAACAGGTGGAGAGGAAGG - Intergenic
1164936277 19:32216998-32217020 GGGCAAAGAGGAGGAGAGGTAGG - Intergenic
1165181268 19:33973036-33973058 GGACAAACAGGAGAGGGGGAGGG - Intergenic
1165435264 19:35791721-35791743 GGGCCAACAGGAGGCGGGGCTGG + Intergenic
1165510453 19:36263910-36263932 GGAGAAAAAGGAGGAATGGAGGG + Intergenic
1166836697 19:45671491-45671513 GGGCAAAGAGGAGCAGGAGAGGG - Intronic
1167900910 19:52621652-52621674 GGGGAAGTAGGAGGAATGGAGGG - Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168427865 19:56253320-56253342 GGGCAGGGAGGAGGGGTGGAGGG + Intronic
925258444 2:2509310-2509332 GGCCCAAGAGGAGGAGAGGATGG + Intergenic
925511260 2:4627844-4627866 GGGAAAAGAGGAGGAGGAGAAGG + Intergenic
925683561 2:6448387-6448409 GGGAAAAGAGAAGTAGTGGAGGG + Intergenic
925923693 2:8655376-8655398 GTGCAACCAGGTGGTGTGGATGG - Intergenic
928126657 2:28621033-28621055 TGGGAAACCGGAGGAGAGGAGGG + Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929588084 2:43128405-43128427 GGGGGAAGAGGAGGAGAGGAGGG + Intergenic
930373877 2:50539855-50539877 GGACAAAAAGAAGAAGTGGAGGG + Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931236801 2:60418910-60418932 GGAGAAAAAGGAGGAATGGAAGG - Intergenic
931285373 2:60827688-60827710 GGCCAGAAAGGAGGAGTGGGTGG - Intergenic
931706737 2:64952402-64952424 GGCCATACAGGAGGAGAGGAAGG + Intergenic
932739276 2:74279418-74279440 GGGCAACCAGGAGGTTAGGAGGG - Intronic
932813693 2:74844737-74844759 GGGCAGACAGGTGGACTGGGAGG + Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
934039832 2:88118573-88118595 AGGCAGAGAGGAGGCGTGGAGGG + Intergenic
934747154 2:96766919-96766941 GGACAGACAGGAGGAGTGCCTGG + Intronic
936087733 2:109480728-109480750 GGGGATCCAGGAGGAGAGGAGGG - Intronic
936403346 2:112182560-112182582 GGGCTAAAAGGAGGAGTGAGAGG - Intronic
936780533 2:116027481-116027503 GATCACAGAGGAGGAGTGGAAGG + Intergenic
937254490 2:120545569-120545591 GGGCAAAGAGGATGACTGGATGG + Intergenic
939006227 2:136790868-136790890 GGGGAAACAGCGGGAGTTGATGG + Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940216668 2:151310073-151310095 GGAGAAGAAGGAGGAGTGGAGGG - Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
940737614 2:157471284-157471306 GGGCAAACAGGCCCATTGGAGGG - Intronic
942017181 2:171829066-171829088 GGGGAATCAGGTGGAATGGATGG - Intronic
942462644 2:176178751-176178773 GGGCACGCAGGAGGTGTGGCAGG - Intergenic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943522863 2:188975800-188975822 GGGCAAAGCGAAGGAGAGGAGGG - Intronic
944177069 2:196842449-196842471 AAGCAAACAAGAGAAGTGGATGG - Intronic
945614783 2:212054064-212054086 GGGGCAAGAGGAGGAGGGGAAGG - Intronic
945632755 2:212303017-212303039 GGGGAAAGAAGAGGAGTGTAGGG + Intronic
945942286 2:215961721-215961743 GGTCAAAAAGGAGGAGAGGCTGG - Intronic
946040630 2:216780469-216780491 GGGGAAAGAGGAGGAAGGGAAGG + Intergenic
946375117 2:219303117-219303139 GGGCAAACAGGAGCAGGGGAAGG + Intronic
947469025 2:230382826-230382848 GTGCAGACAGGAGGAGATGAGGG + Intronic
947687689 2:232104565-232104587 GGGGAGAAATGAGGAGTGGATGG - Intronic
947825635 2:233104515-233104537 GGGCAAACAGAAGGTGAGGTCGG + Intronic
948451758 2:238079895-238079917 GGGAAAACAGGAGTAGCAGAAGG - Intronic
948454607 2:238099002-238099024 GGGGAAGCAGGAGGGGTGGTGGG - Exonic
1168963599 20:1885526-1885548 GGGGCAACAGGCTGAGTGGAGGG + Intergenic
1169276081 20:4234609-4234631 GAGCAAACTGGGGGAGAGGAAGG - Intronic
1169557866 20:6768662-6768684 GGGCAAGGCCGAGGAGTGGAGGG - Exonic
1169571075 20:6906083-6906105 GGGCAGAGAGGAGGAGGGGAGGG - Intergenic
1170036484 20:11995450-11995472 GGGCAGAGAGGTGAAGTGGAGGG - Intergenic
1170407860 20:16058534-16058556 GGACAGAGAGTAGGAGTGGAAGG - Intergenic
1170821335 20:19758153-19758175 GAGGAAAGAGGAGGAGGGGAGGG - Intergenic
1170851431 20:20008353-20008375 GGGCAAACAGGAGCAGCGGAGGG + Intergenic
1170928436 20:20746698-20746720 GAGGAAAGAGGAGGAGAGGAGGG + Intergenic
1171307462 20:24118599-24118621 GGGCAAACAGGAGCCATGGGCGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172011110 20:31846413-31846435 GTGCAAACACAAGGAGTGAAAGG + Intergenic
1172044506 20:32070918-32070940 GGGGAAGGAGGAGGAGGGGAAGG + Intronic
1172114452 20:32565232-32565254 GGACACACAGGCCGAGTGGACGG + Intronic
1172617475 20:36298751-36298773 GGGCAAGTGGGAGGGGTGGAAGG - Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173065220 20:39704114-39704136 GGGGAAACAAGAGGGGTGAAGGG + Intergenic
1173088564 20:39948636-39948658 GAGCAAACAGAATGGGTGGAAGG - Intergenic
1173136270 20:40441994-40442016 GGGTACACAGTAGGAGTGTAAGG - Intergenic
1173790774 20:45826569-45826591 AGGGAAAGAGGAGGAGAGGAAGG - Intronic
1174151878 20:48491772-48491794 AGGCAAACAGAGGGAGAGGAAGG - Intergenic
1175734758 20:61377394-61377416 GGGCAACCAGGAGGCGGGGCCGG - Intronic
1176085218 20:63292775-63292797 GGGCATACTGGGGGAGGGGAAGG + Intergenic
1176085297 20:63293076-63293098 CGGCAGACAGGAAGGGTGGAGGG + Intergenic
1176653423 21:9570098-9570120 GTGATAACAGGAGGAGGGGAAGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178376672 21:32073282-32073304 GGCCAAGCAGGAGGATTGCAGGG - Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179268931 21:39833232-39833254 GGGGAAACAGGAGCCGGGGAAGG - Intergenic
1179277607 21:39906547-39906569 GGGGAAGAAGGAGGAGCGGAAGG - Intronic
1179458315 21:41515041-41515063 GGCCAAACAGGAGGGTTGAATGG + Intronic
1179948715 21:44697830-44697852 GGGGACACAGCAGGAGGGGACGG - Exonic
1180009963 21:45042966-45042988 GGGCAGCCTGGAGGAGGGGAAGG + Intergenic
1180205376 21:46256262-46256284 GGGTAACCAGGAGGAGTGGCAGG + Intronic
1180875493 22:19173307-19173329 GTGCACATCGGAGGAGTGGATGG - Intergenic
1181032640 22:20155645-20155667 GGACAAAGAGGAGGAGAGGCTGG + Intergenic
1181147351 22:20858524-20858546 GGGCTGACAGGAGGAGGGGCTGG - Intronic
1181432250 22:22888627-22888649 GGGCAGAGAGGAGGAGGGGGAGG - Intronic
1181434440 22:22901997-22902019 GGGAAATCAGGAGAAGTGAAGGG + Intergenic
1181510791 22:23387967-23387989 GGGCAAAGAGGAGGAGAGGCTGG - Intergenic
1181626924 22:24128663-24128685 GAGGAAACAGGAGTGGTGGAGGG - Intronic
1182084744 22:27553820-27553842 TGGCTACCAGGAGGAGTGAAAGG + Intergenic
1182322729 22:29489071-29489093 GGCCAAAGAGGAGGAGGGCAAGG + Exonic
1183622999 22:38985753-38985775 GGGGGAGCAGGAGGAGTGCAGGG - Intronic
1183633004 22:39044882-39044904 GGGGGAGCAGGAGGAGTGCAGGG - Intronic
1184095602 22:42314660-42314682 GAGCAGACAGGAGGGGTGCAGGG - Intronic
1184453188 22:44594888-44594910 GGGGGGACAGCAGGAGTGGAGGG + Intergenic
1184507651 22:44914017-44914039 GGGAAGAGAGGAGGGGTGGAGGG + Exonic
1185159402 22:49213929-49213951 GGGCAAGAAGCAGCAGTGGAAGG - Intergenic
1185334437 22:50265321-50265343 GCGCACGCTGGAGGAGTGGAAGG - Exonic
1203296616 22_KI270736v1_random:48195-48217 GGGCAATGGGGAGGAATGGAGGG + Intergenic
949671011 3:6398925-6398947 GGAGAAAAAGGAGGAATGGAGGG - Intergenic
949943573 3:9172999-9173021 AGGCAAACAGGAGAGGTGGTGGG + Intronic
950032166 3:9860453-9860475 GGACAAACAGGAGGAAGAGATGG - Intergenic
950529359 3:13544341-13544363 GGGCTGAGAGGAGGAGGGGAAGG - Intergenic
950543495 3:13625833-13625855 GGGTGAGCAGGAGGAATGGAGGG - Intronic
950565353 3:13766706-13766728 TGGGAAGCAAGAGGAGTGGAGGG - Intergenic
950749897 3:15120276-15120298 GGGCAAGCAGGAGGCGAGGAAGG + Intergenic
951889138 3:27552604-27552626 GGAGAAGAAGGAGGAGTGGAGGG + Intergenic
952207196 3:31191818-31191840 GGGCAGAAAGGAGGAGAGAAAGG - Intergenic
952595164 3:35008681-35008703 GGGAAAAAAAGAAGAGTGGATGG - Intergenic
952728597 3:36615847-36615869 GAGCAAACAGGAGATGAGGATGG + Intergenic
952970542 3:38648236-38648258 GGTCAAACAGATGGAGTTGAGGG + Intronic
953140596 3:40226002-40226024 GGGCTGAAAGGAGGACTGGAGGG + Intronic
953866371 3:46586753-46586775 GAGCCAACAGGAGGAATGGAGGG + Intronic
954002117 3:47566010-47566032 GGGCAGAGAGGAGCAGAGGAGGG + Intronic
954161946 3:48729210-48729232 GGGGAAGAAGGAGGAATGGAGGG + Intronic
954447996 3:50557002-50557024 GGGCAGGCAGCAGGAGCGGATGG + Intergenic
955253216 3:57304940-57304962 GGAGAAAAAGGAGGAATGGAGGG - Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955916689 3:63913522-63913544 GGAGAAACAGGAGTAGAGGAAGG + Intronic
956557086 3:70536071-70536093 GGGAAAGCAAGAGGAATGGAAGG - Intergenic
958073820 3:88650576-88650598 GGGAGAAAAGGAGGAGTGCAAGG + Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
959725226 3:109534492-109534514 GAGCAAAATGGAGGAGTAGAAGG - Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960906451 3:122606532-122606554 GAGGAAACAGTAGGAGAGGAGGG - Intronic
960948383 3:122982605-122982627 GGGGAAACAGGAGGAGGGCTGGG - Intronic
961071403 3:123931861-123931883 GGACAGAGAGGAGGAGTGGAAGG - Intronic
961208465 3:125106684-125106706 GGGCAAAGAGGAGGAGATGAGGG - Intronic
961536913 3:127576057-127576079 GGGCAAGCAGGAAGGGAGGAAGG + Intronic
961712916 3:128841002-128841024 GGAGAAAAAGGAGGAATGGAGGG + Intergenic
961748535 3:129081638-129081660 GGGAAAGCAGGCAGAGTGGAGGG + Intergenic
962795358 3:138845196-138845218 AGGCAAAGAGCAGGAGAGGAAGG + Intergenic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
964381851 3:156105373-156105395 TGGCAAACAGGAGGTGAGGCAGG - Intronic
964474986 3:157090076-157090098 AGGGAAACAGGAAGAGTGCATGG - Intergenic
966232985 3:177670272-177670294 GGACAAGAAGGAGGAATGGAGGG + Intergenic
966279149 3:178208794-178208816 GGGCAAACAGGGGGAATGGAGGG - Intergenic
966908566 3:184544734-184544756 GGGGGAACAGGAGGAGTAGGAGG - Intronic
967959581 3:194909736-194909758 GGAGAAACAGGAGAAATGGAAGG - Intergenic
968739833 4:2321880-2321902 GGGCAGTCAGCAGGAGTGGGGGG + Intronic
968816628 4:2824844-2824866 GGGCAAAGAGAAGGTGTGGCTGG + Intronic
969052017 4:4379918-4379940 GGGCCAGCAGGAGGAGGGGAGGG + Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969423164 4:7108902-7108924 GGGCAGAGAGGAGGGGTGGGTGG - Intergenic
969495213 4:7522706-7522728 GGGAAAACGGGAGAAGGGGAAGG - Intronic
970971546 4:21989937-21989959 GGGGAAAGAGGAGGAGGAGAAGG - Intergenic
971153166 4:24055422-24055444 GTGCAAGTAGGAGGGGTGGAAGG + Intergenic
971784618 4:31084698-31084720 GGGGAAAAGGGAGGAGGGGAGGG + Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974786330 4:66623213-66623235 GGCCAAACAGGAGAACTGAATGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975551209 4:75614775-75614797 GGTCAAACAGGAGTATAGGAAGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978806101 4:112802104-112802126 GGAGAAACAGGAGGAGTGGCAGG + Intergenic
978908326 4:114036271-114036293 GGGCAAAAAAGTGGAGTGGAGGG + Intergenic
979146475 4:117253356-117253378 GGAGAAGAAGGAGGAGTGGAGGG - Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980280592 4:130714330-130714352 GGGCAGAGAGGAAGAGAGGAAGG - Intergenic
980568827 4:134583078-134583100 GGAGAATGAGGAGGAGTGGAGGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980850053 4:138370516-138370538 GGGAAAACAGTAGCAGTGAAAGG + Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984014031 4:174405010-174405032 GGGGAAAGAAGAGGAGGGGAGGG - Intergenic
985221617 4:187711909-187711931 GGGGACACATGAGGAGTGAATGG - Intergenic
985496184 5:207762-207784 GAGCATCCAGGAGGTGTGGAGGG + Intronic
985514268 5:331668-331690 GGCCAAACAGCAGGAGTGAGTGG + Intronic
985652289 5:1112582-1112604 GGGCAAACAGGAGGGGGTGCGGG - Intergenic
986210790 5:5670013-5670035 GGGTAAATATTAGGAGTGGAAGG + Intergenic
986392662 5:7300571-7300593 GGGGAAGCAGGAGGAGCAGATGG - Intergenic
986502440 5:8414989-8415011 GGGGAAGAAGGAGGAATGGAAGG - Intergenic
986576757 5:9220993-9221015 GCAGAAACAGGAGGAGTGGAGGG - Intronic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989563757 5:42880379-42880401 GGGCATATAGGAGGAGGGGAAGG - Intronic
989615303 5:43332419-43332441 GGGGAAGAAGGAGGAATGGAGGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990866224 5:60383415-60383437 GGGCTAAAAGGAGAAATGGAAGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995023564 5:107393897-107393919 GGGGAAACAGAAGAAGTGGTGGG + Intronic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
996145322 5:119967712-119967734 AGGGAAAAAGGAGGAGTGTAGGG + Intergenic
996344175 5:122471817-122471839 GGAAAAACAGGGGGAGTAGAAGG - Intergenic
997195274 5:131975066-131975088 GGGTAAACAGGAAGAGGGGGAGG + Intronic
997294871 5:132762964-132762986 GGCCTAACAGAAGGAGTGGTGGG + Intronic
997456343 5:134020347-134020369 GGGTAAACAGGAGCTGGGGAGGG - Intergenic
997676235 5:135715113-135715135 GGGCAAATATGAGGAGGTGAGGG + Intergenic
999326882 5:150649367-150649389 GGGCATTCTGGAGGAGTCGATGG + Exonic
999381773 5:151126373-151126395 GGTCAAGCAGGAGGAGGGGAAGG + Intronic
999715745 5:154358617-154358639 GGGCACACAGGAGGAGTGGGAGG - Intronic
1000102795 5:158032951-158032973 GGGAAAACGGGAGGAATGAAGGG - Intergenic
1000202341 5:159023882-159023904 GGGCAAACAGGAGGAGTGGAAGG + Intronic
1000288850 5:159850940-159850962 AGACACACAGGAGGAGTGAAGGG + Intergenic
1000456688 5:161457926-161457948 GGAGAAACAGGAAGAGTGCAGGG + Intronic
1000894593 5:166840417-166840439 GGGCATACTGGATGAGTGAAAGG - Intergenic
1001315684 5:170639688-170639710 GGGGAGACAGGAGGAGAGGAAGG - Intronic
1001438296 5:171718175-171718197 AGGCAAACAGGAGGTGGGGGAGG - Intergenic
1001652944 5:173328287-173328309 GAGCAAAAAGGAAGAGTGGGAGG - Exonic
1002092629 5:176813953-176813975 GGGAGAATAGGAGGAGGGGACGG - Intronic
1002571576 5:180142682-180142704 GGGAAAACAGCAGGAGAGAAAGG + Intronic
1002829344 6:805012-805034 GGGCAGACAGGAGGAGTCAAAGG - Intergenic
1002836418 6:868854-868876 AGGCAAGCAAGAGGAGAGGAGGG - Intergenic
1003713964 6:8625296-8625318 GGGAAAACTGGAGGAGTGGGGGG - Intergenic
1003832410 6:10027742-10027764 GGGAAAAAAGGAAGAGCGGAAGG + Intronic
1003955925 6:11164960-11164982 GGGCAAAGAGGAGGACTGGCTGG + Intergenic
1004018984 6:11759215-11759237 GGGCAGAGAGGGGAAGTGGAAGG + Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1006167910 6:32076131-32076153 GGGCAAAAAGGAGCAGGGAATGG - Intronic
1006429179 6:33984629-33984651 GGGCAACCAGGAGGACGGCAGGG + Intergenic
1006471863 6:34234148-34234170 GGAAATACAGGAGGAGAGGATGG - Intergenic
1006598278 6:35209279-35209301 GGGCAGAGAGGAGGGGTGGGAGG + Intergenic
1006634701 6:35453585-35453607 GGGTATCCAAGAGGAGTGGAAGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1008627066 6:53327130-53327152 AGGCAGACAGGAGGAGTGAGTGG - Intronic
1008824762 6:55680594-55680616 GGGCAAACAGCTGGTGTGGCCGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009999446 6:70933813-70933835 GGGGCAACAGGAGCTGTGGAAGG - Intronic
1010709339 6:79154282-79154304 CGGAAAACTGGAGGAGGGGAAGG - Intergenic
1011707202 6:90013472-90013494 GGGAAAACAAGGGGAGGGGAGGG - Intronic
1012038775 6:94176745-94176767 GGGCACACAGGAGACATGGAAGG - Intergenic
1012596004 6:101041054-101041076 GGGCAAAAAGAAGGAGAAGAAGG - Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1012981070 6:105831064-105831086 GGGGAAGCTGGAGGAGGGGAAGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013701761 6:112779567-112779589 GGAAAAGCAGGAGGAGTAGAAGG - Intergenic
1014134388 6:117871270-117871292 GGGCAAGCGGAAGGAGTGGGGGG + Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014374931 6:120660548-120660570 AGGCAAACTGCAAGAGTGGAGGG - Intergenic
1015761500 6:136666473-136666495 AGGCCAACAGGAGGAATGGGAGG + Intronic
1015844042 6:137499010-137499032 GGGAAAATAGCAGAAGTGGAAGG + Intergenic
1016027974 6:139308158-139308180 AGGCAAATAGGCAGAGTGGAAGG + Intergenic
1016340981 6:143061073-143061095 GGGCGAGCAGGGGGAGGGGACGG - Intronic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1017041859 6:150314397-150314419 GGGAGAACAGGAGGAGGAGAGGG + Intergenic
1017432014 6:154380846-154380868 TGTCAAGCAGGGGGAGTGGAAGG + Intronic
1018658103 6:166059443-166059465 GAGCAAACAGGATGAGGGAAAGG + Intergenic
1019019393 6:168905021-168905043 AGGCACACAGGAGGAAAGGAGGG - Intergenic
1019618232 7:1976665-1976687 GGCCAATCAGCAGGAGTGGGTGG - Intronic
1021247141 7:18277400-18277422 GTGCAAATTGGAAGAGTGGAAGG + Intronic
1021449078 7:20764789-20764811 AGGAAAAGAGGAGAAGTGGAAGG + Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022011172 7:26309226-26309248 GGGCTAACCGGAAGAATGGAGGG - Intronic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1023127627 7:36971457-36971479 GGGGGAACAGGAGGAGTCAAGGG + Intronic
1023473130 7:40546807-40546829 GAGCAAAAAGGATGAGTGGATGG - Intronic
1023558601 7:41449165-41449187 GGGCTGGCAGGAGGAGTGGATGG + Intergenic
1023763484 7:43488748-43488770 TGGAGAACAGGAGGATTGGATGG - Intronic
1023991684 7:45132533-45132555 GGGAAAAAAGGAGGAAGGGAGGG + Intergenic
1024412048 7:49054872-49054894 GGGGAAACATGAGGAGTACATGG - Intergenic
1024416302 7:49111481-49111503 GGAGAAGCAGGAGGAGAGGAGGG - Intergenic
1024709723 7:52002049-52002071 TGGGAAACAGCAGGAGAGGAAGG + Intergenic
1025789869 7:64679622-64679644 GGACAAGGAGGAGGAATGGAGGG - Intronic
1027054594 7:75041270-75041292 GAGAAAGCAGGAGGAGAGGATGG - Intronic
1027587966 7:80081586-80081608 GGGCAGACAGGGGTAGCGGATGG + Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028394032 7:90347894-90347916 GAGCAAAGAGGAAGAGAGGAAGG + Intronic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028768817 7:94591623-94591645 GGGCCAACAAGAGAAGTGGGGGG - Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029530369 7:101121489-101121511 GGGGATACAGCAGGAGAGGAGGG + Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031083756 7:117282440-117282462 GGAGAAAGAGGAGGAGAGGAAGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031897242 7:127364666-127364688 GGGTAAAGAGGAGGAGTTGTTGG + Intronic
1032447557 7:131997660-131997682 GAGCAAACAGGAGTGATGGATGG - Intergenic
1033270881 7:139931869-139931891 GGACAAGCAGGAGGTGTGGAGGG + Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034412432 7:150948318-150948340 GGGCACACTGGAGGAAGGGATGG + Intronic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035213398 7:157346015-157346037 GGGCCCTCAGGAGGACTGGAAGG - Intronic
1035226762 7:157438116-157438138 GGGGAAAGATGAGGAGGGGAGGG - Intergenic
1035226769 7:157438136-157438158 GGGGAAAGATGAGGAGGGGAGGG - Intergenic
1035226776 7:157438156-157438178 GGGGAAAGATGAGGAGGGGAGGG - Intergenic
1035560533 8:600985-601007 GGACAGAGAGGAGCAGTGGAAGG + Intergenic
1035560553 8:601065-601087 GGACAGAGAGGAGCAGTGGAAGG + Intergenic
1035560573 8:601145-601167 GGACAGAGAGGAGCAGTGGAAGG + Intergenic
1035560593 8:601225-601247 GGACAGAGAGGAGCAGTGGAAGG + Intergenic
1035560614 8:601305-601327 GGACAGAGAGGAGCAGTGGAAGG + Intergenic
1035560635 8:601385-601407 GGACAGAGAGGAGCAGTGGAAGG + Intergenic
1036450671 8:8864373-8864395 GGGCAAAGAGGAGGAGGAGTCGG - Intronic
1036683145 8:10890798-10890820 GGGCAGACAAGAGGAGTGAATGG - Intergenic
1037367084 8:18134673-18134695 GGGGAAAAAGGAGGTGTAGAAGG + Intergenic
1037605618 8:20435133-20435155 GGGGAAAGAGGAGGAGAGGACGG - Intergenic
1038078455 8:24104351-24104373 AGGCAGCCAGGAGGATTGGAGGG - Intergenic
1038156540 8:24996732-24996754 GTGCAAGCTGGAGGAGTGTATGG + Intergenic
1038581232 8:28750987-28751009 GGGGCAGCAGGAGGAGTGGAAGG + Exonic
1038941745 8:32312805-32312827 AGGCAAACAGGAAGGATGGAAGG - Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1039784332 8:40819444-40819466 GGGGAGACTGGAGGAGGGGAGGG - Intronic
1040638498 8:49303844-49303866 GGGCAACCTCTAGGAGTGGAAGG - Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1043196206 8:77295486-77295508 TGGCAAACACGTGAAGTGGAGGG + Intergenic
1043354075 8:79392052-79392074 GGGTACACAGGAGAAGGGGATGG + Intergenic
1044556859 8:93572185-93572207 GGGCAAACAGGGAGGGTGGCAGG - Intergenic
1044840612 8:96333662-96333684 GGGCAAGCAGGAAGAGGCGAGGG + Exonic
1045238866 8:100380234-100380256 GGGCAAAGAGGAGCAGGGGTAGG - Intronic
1045459395 8:102412749-102412771 GGGCAAACGGGAGGAGGAGGAGG + Exonic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046059043 8:109114464-109114486 GGGAAGACAGAAGGAATGGAAGG + Intronic
1046074750 8:109302078-109302100 GGAGAAAAAGGAGGAATGGAGGG - Intronic
1047124828 8:121948464-121948486 AGGCACACAGGAGGACTGGCAGG + Intergenic
1047597652 8:126395003-126395025 GTGCTTACAGGGGGAGTGGAAGG - Intergenic
1048437442 8:134431608-134431630 GGGAAGACAGGAGGAGTTGCAGG + Intergenic
1048530186 8:135240967-135240989 GAACAAGCAGGAGGAGTGGGAGG - Intergenic
1048852225 8:138656190-138656212 GGGCAAACAGAAGGAGAGTAGGG - Intronic
1048891899 8:138955706-138955728 AGGCCAACAGGAAGACTGGAAGG + Intergenic
1049478878 8:142810606-142810628 GGGAAAAAGGGAGGGGTGGAGGG - Intergenic
1049615307 8:143573269-143573291 GGGCAGCCCGGAGGTGTGGAGGG + Intergenic
1050116061 9:2264607-2264629 AGGCAATCAGCAGCAGTGGATGG + Intergenic
1050185637 9:2969933-2969955 GAGTAAACAGAAGGAATGGATGG + Intergenic
1050744222 9:8858023-8858045 GGGCGAGCAGGAGGAGCGGGAGG - Intronic
1050758429 9:9036743-9036765 GGACAAACAGGAGAGGAGGAAGG - Intronic
1051130424 9:13854012-13854034 GAGCAAACAGGTGGAGTGGGAGG - Intergenic
1052821104 9:33138408-33138430 GGTAAACCAGGAGGAGTGCAGGG + Intronic
1053006278 9:34606935-34606957 GGGCCTACAGGAGGAATGGCAGG - Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053831767 9:42089730-42089752 GGAGAAATATGAGGAGTGGAGGG + Intronic
1054598777 9:67097716-67097738 GGAGAAATATGAGGAGTGGAGGG - Intergenic
1054907144 9:70421179-70421201 GGGGAGTCAGGAGGAGAGGAAGG - Intergenic
1056459630 9:86797282-86797304 GGGGAAACAGGAGGTGCGAAGGG - Intergenic
1057323088 9:94032158-94032180 GAGCCAACAGGATGAGTGGGTGG - Intronic
1058445882 9:105054429-105054451 GGGCAAAATGGGGAAGTGGATGG - Intergenic
1058947843 9:109875500-109875522 GGGGACACAGAAGGAGAGGATGG + Intronic
1059213236 9:112534318-112534340 TGGCAAAAATGAGCAGTGGAAGG - Intronic
1059429090 9:114239465-114239487 GGTCACACAGGAGGAGGGCAGGG + Intronic
1059888865 9:118778673-118778695 GGGCAAACAGAAGGAGTAAGAGG - Intergenic
1060545410 9:124456376-124456398 TGGCAAACAGGAGGATGGGGTGG + Intronic
1060896982 9:127224762-127224784 GGGCAAGCAGCAGGAGGGGTGGG + Intronic
1061505099 9:131027253-131027275 GGGCACAAATGAGGCGTGGAAGG + Intronic
1061509268 9:131050445-131050467 GGGCAAAGAGCAGGAGCTGAGGG + Intronic
1061764814 9:132875055-132875077 GGGGAAGGAGGAGGAGGGGAAGG + Intronic
1061848087 9:133399410-133399432 GGTCGAAGAGGAGGAGGGGAGGG - Intronic
1062028123 9:134349901-134349923 ACCCAAACAGGAGGAGAGGAAGG - Intronic
1062167544 9:135115433-135115455 GGGCAGAAAGGATAAGTGGACGG + Intronic
1062225212 9:135446518-135446540 GGGGAAACAGGTGAAGAGGAAGG + Intergenic
1062225224 9:135446560-135446582 GGGGAAACAGGTGAAGAGGAAGG + Intergenic
1062225239 9:135446607-135446629 GGGGAAACAGGTGAAGAGGAAGG + Intergenic
1062225256 9:135446653-135446675 GGGAAAACAGGTGAAGAGGAAGG + Intergenic
1062225276 9:135446701-135446723 GGGGAAACAGGTGAAGAGGAAGG + Intergenic
1062225294 9:135446748-135446770 GGGGAAACAGGTGAAGAGGAAGG + Intergenic
1062225311 9:135446794-135446816 GGGGAAACAGGTGAAGAGGAAGG + Intergenic
1062225327 9:135446840-135446862 GGGGAAACAGGTGAAGAGGAAGG + Intergenic
1062225347 9:135446888-135446910 GGGGAAACAGGTGAAGAGGAAGG + Intergenic
1062225364 9:135446934-135446956 GGGAAAACAGGTGAAGAGGAAGG + Intergenic
1062225384 9:135446982-135447004 GGGGAAACAGGTGAAGAGGAAGG + Intergenic
1062225402 9:135447029-135447051 GGGGAAACAGGTGAAGAGGAAGG + Intergenic
1062225419 9:135447075-135447097 GGGGAAACAGGTGAAGAGGAAGG + Intergenic
1062225435 9:135447121-135447143 GGGGAAACAGGTGAAGAGGAAGG + Intergenic
1062225455 9:135447169-135447191 GGGGAAACAGGTGAAGAGGAAGG + Intergenic
1062225472 9:135447215-135447237 GGGGAAACAGGTGAAGAGGAAGG + Intergenic
1203631143 Un_KI270750v1:73545-73567 GTGATAACAGGAGGAGGGGAAGG + Intergenic
1186451860 X:9680569-9680591 AGGCAAGCAGGAGGGCTGGATGG - Intronic
1186943606 X:14540414-14540436 TGGAAAACAGGAGGAGGGCAAGG - Intronic
1187522194 X:20023509-20023531 AGGCAACGAGGAGGAGTGGTAGG + Intronic
1188552504 X:31378780-31378802 GGAGAAAAAGGAGGAATGGAGGG - Intronic
1189249040 X:39585836-39585858 GGGGCAGGAGGAGGAGTGGAAGG + Intergenic
1189700650 X:43714550-43714572 GGGGAGACAGGAGGTGTAGATGG + Intronic
1190473721 X:50808057-50808079 GAGGAAACAGGAGGAGAGGCTGG + Intronic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192109382 X:68348923-68348945 TGGCAAGTAGGAGGTGTGGAGGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192764762 X:74129309-74129331 GTGGAGACAAGAGGAGTGGATGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1194008001 X:88521241-88521263 ATTCAAACAGGAGGAGAGGAAGG + Intergenic
1194244788 X:91497587-91497609 GAGCAAACAGGAGGAAAGAAAGG - Intergenic
1195200638 X:102547138-102547160 GGCCAAGGAGGAGGAGGGGATGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196469704 X:116011573-116011595 GGGGAAGAAGGAGGAATGGAGGG - Intergenic
1196633267 X:117968091-117968113 GGACAACCAGGAAGAGTGAAGGG + Intronic
1196782835 X:119399041-119399063 GGGCAAACCAGAGGAGAGGCAGG + Exonic
1196891076 X:120291472-120291494 GGTCATGCAGGATGAGTGGAAGG + Intronic
1197833257 X:130667911-130667933 AGACAAACAGGAAGAATGGAAGG + Intronic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198009393 X:132535515-132535537 GGGCAAACAGGATAAAAGGATGG - Intergenic
1198063371 X:133070399-133070421 GAGTAAACAGGAGGAGTCCAAGG - Intronic
1198231721 X:134696338-134696360 GGGTAATGAGGGGGAGTGGAGGG + Intronic
1198253909 X:134908456-134908478 AGGGAAACAGAAGGAGGGGAGGG - Intronic
1198795602 X:140390913-140390935 AGGCAATAAGGAGGAGAGGATGG + Intergenic
1199599871 X:149535501-149535523 GAGAAAAGAGGAGGAGAGGAGGG - Intergenic
1199817039 X:151407641-151407663 GGCCAAACAGGAGGTGAGGAAGG - Exonic
1200179346 X:154140916-154140938 GGGCAGACAGGGCGAGCGGAGGG + Intergenic
1200563763 Y:4738896-4738918 GAGCAAACAGGAGGAAAGAAAGG - Intergenic
1200982376 Y:9273892-9273914 AGGCAGATAGGAGGAGTAGAAGG + Intergenic
1201078011 Y:10200899-10200921 GGGCAGGCAGGAGAAGAGGACGG - Intergenic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic
1201718299 Y:17071056-17071078 GGAGAAACAGGAGGAGTGTCGGG + Intergenic