ID: 1000202811

View in Genome Browser
Species Human (GRCh38)
Location 5:159028287-159028309
Sequence CTTCCTTGTCACCAAGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000202811_1000202812 7 Left 1000202811 5:159028287-159028309 CCAGGAACTTGGTGACAAGGAAG 0: 1
1: 0
2: 3
3: 18
4: 178
Right 1000202812 5:159028317-159028339 AAACCCAATAAATATACTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000202811 Original CRISPR CTTCCTTGTCACCAAGTTCC TGG (reversed) Intronic
900604899 1:3519586-3519608 CTTACTTGTCACCAGAGTCCCGG + Intronic
900635374 1:3662250-3662272 CTTTCATGTCACCAAGCTGCAGG + Intronic
901005049 1:6167518-6167540 CTCCCATGCCACCAATTTCCAGG + Intronic
901894000 1:12293213-12293235 ATTCCTGCTCACCATGTTCCTGG - Intronic
904633569 1:31861778-31861800 CTTCTCTGTAACAAAGTTCCCGG + Intergenic
904857741 1:33511704-33511726 CTTCTTTGTCCCCAGGTTCTTGG + Intergenic
907372256 1:54011117-54011139 CCCCCTTGTGACCCAGTTCCTGG - Intronic
907574151 1:55510792-55510814 CTTCCTTGTCTAAAAGTTGCCGG - Intergenic
907763043 1:57380527-57380549 CATCATTGTCACTATGTTCCAGG - Intronic
907841445 1:58161800-58161822 CTGCATTGTCACCAAGAGCCTGG + Intronic
908846779 1:68332745-68332767 ATTCCTAGTCAACAAGTTCTGGG + Intergenic
909153167 1:72034965-72034987 CTTCCTTGTCACCACGTTTATGG + Intronic
910289582 1:85587515-85587537 CTTACTTGGCACCCAGGTCCTGG + Intergenic
910760019 1:90724284-90724306 CCTGCTTTTCACCAAATTCCCGG + Intergenic
911070634 1:93829334-93829356 TTTCCTTGTCACCAGGTTTATGG - Intronic
911728653 1:101268856-101268878 CTGACTTGCCACCAAGTTACGGG - Intergenic
912207702 1:107526481-107526503 CTTATTTCTCTCCAAGTTCCAGG - Intergenic
912377537 1:109223454-109223476 TTTCCTTGTCACCAAATGCTGGG + Intronic
912572252 1:110633260-110633282 CTTCCTTTTCACCAGGATCTGGG - Intergenic
914965055 1:152249166-152249188 CTTTCTTCTTACCATGTTCCTGG - Intergenic
915210572 1:154305840-154305862 CTTCCCTGTCAGCAAGTCACAGG + Intergenic
916477700 1:165185913-165185935 CCTCCTTGTAAACAAGTTTCTGG + Intergenic
917258096 1:173138192-173138214 CTCCCTAGTCAGCAAGTCCCGGG + Intergenic
917787549 1:178475033-178475055 CCTCCTTTTCACCAAGTCCCAGG + Intronic
919983368 1:202656427-202656449 CATCCTTGGCTCCAAGTTTCAGG - Intronic
919986099 1:202676256-202676278 TTTCCTTGTCCCCAACTCCCTGG - Intronic
919997174 1:202763218-202763240 CCTCCTGGTCTCCAAATTCCTGG + Intronic
920055376 1:203187013-203187035 CTTTCTTGCCAGCAATTTCCTGG + Intergenic
922267617 1:223999222-223999244 CTTCCTTCTCACGAAGACCCAGG - Intergenic
923882632 1:238120152-238120174 CCTCTCTGTCACCAAGTTGCTGG + Intergenic
1065844156 10:29730939-29730961 CCTGCTTGTCTCCCAGTTCCTGG - Intronic
1068822243 10:61390458-61390480 TGTCCTTGTCCCCAAGTTCATGG + Intergenic
1071071851 10:81703778-81703800 CTTGCTTGTTACCAAGTGCATGG - Intergenic
1073616817 10:105004512-105004534 CTGCCTAGTCCCCAAGTTTCTGG - Intronic
1075235143 10:120721229-120721251 CTTAATTGTCACCATTTTCCAGG - Intergenic
1076872534 10:133200836-133200858 CTGCCTTGTCACCAAAGCCCCGG - Intronic
1079437969 11:20477051-20477073 CTTCCCTGTGGCCAAGTTCTTGG + Intronic
1083485321 11:62979809-62979831 CTTCCTTGTCATCAACTCCCTGG - Exonic
1084280074 11:68083274-68083296 CTTCCTTGTTACCAAGACCCTGG - Intronic
1090317181 11:125803466-125803488 TTTCAGTGGCACCAAGTTCCAGG - Intergenic
1090628963 11:128629555-128629577 CTTCAGTGTCACCTAGCTCCTGG - Intergenic
1091591420 12:1845180-1845202 CTGCCTTGTGACACAGTTCCTGG + Intronic
1092059388 12:5536144-5536166 CTTCCTGGACACCACCTTCCAGG - Intronic
1092550232 12:9490522-9490544 CTTCCTTATCAACAAATTCGTGG - Intergenic
1093612242 12:21175454-21175476 ATTCCAAGTTACCAAGTTCCCGG + Intronic
1094521576 12:31195851-31195873 CTTCCTTATCAACAAATTCGTGG + Intergenic
1096690064 12:53315057-53315079 CTTCCTTTCCACAAAGCTCCAGG + Intronic
1097691299 12:62736874-62736896 CTTCCTTGTCTTCAAATTCCAGG - Intronic
1097924761 12:65115105-65115127 CCTCCTTGTGACCAAGGGCCTGG - Intronic
1099722168 12:86377864-86377886 CTTCCCTGGCCCCAAGTCCCTGG + Intronic
1103028685 12:117594678-117594700 CTTCCTTATCTCCAAGTTCTTGG - Intronic
1103245648 12:119454839-119454861 CTTCCTGGTCATCCAGTACCTGG + Intronic
1104748272 12:131223230-131223252 CTTCCTTGTCCCCTCTTTCCAGG + Intergenic
1105487118 13:20845514-20845536 CTTCTTTGTCTCCAAGTGCCTGG - Intronic
1105825441 13:24118622-24118644 CTGCATTTTCACCAAGTTCCTGG + Intronic
1107505240 13:41027197-41027219 TTTCTTTGTCACCAATTTTCTGG - Intronic
1112026812 13:95418970-95418992 CTTCTCTGTCACCCAGTTCTGGG + Intergenic
1113348119 13:109500454-109500476 CTTCTTTGTCAGGCAGTTCCTGG - Intergenic
1113915072 13:113865401-113865423 CTTCCATGTCAGCTAGTTACTGG + Intergenic
1114651853 14:24290238-24290260 GTACCTTCTCCCCAAGTTCCAGG + Intergenic
1115427874 14:33281706-33281728 CTTCTTTGTCACAATTTTCCTGG + Intronic
1117791067 14:59342851-59342873 CCTCCTTGACACCACCTTCCCGG - Intronic
1122102283 14:99422703-99422725 CTGCCTTGTCACCAGCTGCCAGG + Intronic
1122206305 14:100149699-100149721 CTTCCTTGCAGCCAAGTACCCGG - Exonic
1125922297 15:43532225-43532247 ATGCCTTCTCACCAAGTTCTTGG - Intergenic
1127372374 15:58353578-58353600 TTTCCTTGTTACCAAGTCACTGG + Intronic
1130152190 15:81319601-81319623 TTTCCATGACACCCAGTTCCTGG - Intronic
1131783033 15:95880776-95880798 CTTCCTTGTCCCCATCCTCCCGG - Intergenic
1132251727 15:100340313-100340335 CTTCCCTGCCCCGAAGTTCCTGG - Intronic
1132390479 15:101434838-101434860 CTTGCTTCTCACCCAGCTCCAGG + Intronic
1132795490 16:1719430-1719452 CTTCCTTTTCAACATTTTCCTGG - Intronic
1134629955 16:15749425-15749447 CTTCCATGTCACCAAGTTGATGG + Intronic
1138370420 16:56522251-56522273 CTTTCTTGTCACAAAGCTCTTGG - Intergenic
1145910327 17:28538606-28538628 CTTCCCTGTCACCCTGTGCCAGG - Exonic
1146123149 17:30212296-30212318 CTCCCTTGGCACCCAGTTCTGGG - Intronic
1153397149 18:4636852-4636874 CTCCCTGGTCTCCTAGTTCCAGG - Intergenic
1154197497 18:12277198-12277220 CTTCCTTGTCATCCAGCACCCGG - Exonic
1155346517 18:24862630-24862652 CTTCCTTGTGACCTGGTTTCTGG - Intergenic
1155911607 18:31510842-31510864 TTTTTCTGTCACCAAGTTCCTGG + Intronic
1156762410 18:40609157-40609179 CTTCCTCATCACCAAATTCTGGG + Intergenic
1157453293 18:47803948-47803970 CATCCCTGTGACCAAGTTTCAGG - Intergenic
1158243064 18:55399315-55399337 CTCCCTGGTCTCCAAGTTTCTGG + Intronic
1158296423 18:56002020-56002042 CTTCATTGTCACCAAATTCCAGG + Intergenic
1159023832 18:63165399-63165421 CTGCCTTGTCTCCATCTTCCAGG + Intronic
1159136998 18:64348076-64348098 GTTCCTTTTCTCCAAGTACCTGG - Intergenic
1162097892 19:8321649-8321671 CCTCCAGGTCACCAAGGTCCTGG + Exonic
1163823035 19:19507181-19507203 CTTCCTTTTCCCCAAATCCCTGG - Exonic
1166305811 19:41936331-41936353 CTTCCATGTCCCAAAGGTCCAGG - Intergenic
1166948655 19:46412390-46412412 CTACCTGGGCAGCAAGTTCCTGG - Exonic
924972470 2:141568-141590 CTTTATTATCACCAAGCTCCTGG + Intergenic
929123817 2:38504873-38504895 CTTCCTTTTCAAAAATTTCCTGG + Intergenic
932002542 2:67897821-67897843 CTTCATTTTCAACAAGATCCTGG - Intergenic
938155795 2:128939086-128939108 CTTCCTTACCACTAGGTTCCTGG + Intergenic
939067798 2:137505341-137505363 CTTCTGTGGCTCCAAGTTCCAGG + Intronic
944605930 2:201351342-201351364 CTTCCGTGGTCCCAAGTTCCAGG + Exonic
945446402 2:209943152-209943174 ATTCCTAGTCACAAACTTCCTGG + Intronic
948362592 2:237433470-237433492 CCTTATTGCCACCAAGTTCCCGG - Intergenic
1170805471 20:19626713-19626735 CATCCTTATCACCAAGTACCAGG + Intronic
1171108674 20:22460259-22460281 CTTCCCAGTCACCTAGCTCCAGG - Intergenic
1171328308 20:24315469-24315491 CTGCCTTGTCAACAAGAGCCTGG - Intergenic
1171727400 20:28637718-28637740 CTTGTTTTTCACCAAGCTCCAGG + Intergenic
1171750841 20:29046901-29046923 CTTGTTTTTCACCAAGCTCCAGG - Intergenic
1173225771 20:41161724-41161746 CCTCCTTGACACCACCTTCCAGG + Intronic
1176313921 21:5224020-5224042 CTTGTTTTTCACCAAGCTCCAGG + Intergenic
1177203550 21:17985023-17985045 CTTCGTTGTCACAAATTTCCAGG + Intronic
1179309830 21:40185637-40185659 CATCACTGTCACTAAGTTCCAGG + Intronic
1180408006 22:12574619-12574641 CTTGTTTTTCACCAAGCTCCAGG - Intergenic
1180922102 22:19526215-19526237 CTTCCATGCCACCATCTTCCTGG + Intronic
1183705662 22:39473755-39473777 CTTGCTTGTCTCCAAGTTCCGGG + Intronic
1183719936 22:39556963-39556985 CTTCATTCTCACCACTTTCCAGG - Intergenic
1184199439 22:42956383-42956405 CTGCCTTGACACCAAGTAACAGG - Intronic
1184593167 22:45499316-45499338 CTTCCCTGACACCCAGTGCCTGG + Intergenic
1184602264 22:45550659-45550681 CTTCCTGGTGACCCAGTTCCCGG + Intronic
949788162 3:7764258-7764280 CTTTCATGTCACCAAGTTTCTGG + Intergenic
949911249 3:8910054-8910076 ATTTCTTGTCACCAACTTTCTGG - Intronic
953757614 3:45660731-45660753 GTTCCTCGTCACCTTGTTCCTGG + Intronic
953792477 3:45958865-45958887 CTTCCCTGGCACCAAGTTGTAGG + Intronic
957875071 3:86133868-86133890 CTTACCTGTCACCAAGTAACTGG - Intergenic
958740616 3:98066008-98066030 CTTGCTTGTCACCTAGCACCTGG - Intergenic
958936466 3:100261112-100261134 CTTCCTTCTCACCATCTTGCCGG + Intronic
958992221 3:100860174-100860196 CTGCCTTTTCAACAAGTTCCCGG + Intronic
960998713 3:123357879-123357901 CTTCCTTGTCCCCAAGGTGTGGG - Intronic
962347367 3:134628024-134628046 CTTTCTTGTCAGCCACTTCCTGG - Intronic
964991467 3:162818221-162818243 CTTCCTTGCCATCAAGATTCTGG + Intergenic
967770199 3:193326023-193326045 GTTCCTTGTCACCCAGTCCAGGG + Intronic
970025416 4:11618735-11618757 CTTCCTTGAAACCCAGTTCTTGG - Intergenic
970328786 4:14957192-14957214 CTACCTTGTCCTCCAGTTCCTGG + Intergenic
971609498 4:28704286-28704308 CCACCTTGTCACCAAGTGCTGGG - Intergenic
977036874 4:91965102-91965124 CTTCCTAGTGATCATGTTCCTGG + Intergenic
978224745 4:106320675-106320697 CTTCCTTGTCACCTCCTTTCAGG - Intronic
979640908 4:123012085-123012107 CTTCCTTCTCTCCACTTTCCTGG - Intronic
979640984 4:123012340-123012362 CTTCCTTCTCTCCACTTTCCTGG - Intronic
979836437 4:125374314-125374336 TTTGCTTGTCACCAAATTTCTGG - Intronic
980169783 4:129275362-129275384 CTTCCTTATCACCCACTTGCAGG + Intergenic
982260264 4:153488456-153488478 GTTCCTTCTCTCCAAGTTCCCGG - Intronic
982757814 4:159244549-159244571 CTTCCTTGACTCAAAATTCCCGG - Intronic
983529720 4:168796845-168796867 CTTCCTTGTCTCCTAATTCGAGG + Intronic
983792407 4:171813805-171813827 CCTCCTTTCCACCAGGTTCCCGG + Exonic
985433203 4:189901329-189901351 CTTGTTTTTCACCAAGCTCCAGG - Intergenic
986551309 5:8959173-8959195 CTTCGTTGTTCCCAAGTTCATGG - Intergenic
988758371 5:34285484-34285506 CTTCCCTGTCCCCAAGGTCAAGG + Intergenic
990621454 5:57563935-57563957 CTTCCTTGCCAGCAAGTTTCTGG - Intergenic
992267456 5:75033194-75033216 CTGCCTTGTCACTCATTTCCAGG + Intergenic
997973668 5:138425476-138425498 CATCCTGGTCTCCAAATTCCTGG - Exonic
999234150 5:150080395-150080417 CTTCCTTGTCACCTATGTCCAGG - Intronic
999409923 5:151341891-151341913 CTTCCTTGTCTCCCAATCCCAGG + Intronic
999706207 5:154274550-154274572 CATCATCGTCACCAAATTCCTGG + Intronic
1000202811 5:159028287-159028309 CTTCCTTGTCACCAAGTTCCTGG - Intronic
1000724377 5:164751500-164751522 CTTCCTAGTCCCTAAGGTCCTGG + Intergenic
1000872613 5:166595782-166595804 CTTTCTTATCAGCAAGCTCCTGG - Intergenic
1001889624 5:175328099-175328121 CCTCCTTGTCATGGAGTTCCAGG + Intergenic
1002473487 5:179451347-179451369 CTTCTGTGTCACCATATTCCAGG + Intergenic
1002694159 5:181072900-181072922 CTTCCCTGTTTCCCAGTTCCAGG - Intergenic
1005137576 6:22588033-22588055 TTTCCTTGTCAGCAAGTTCCTGG + Intergenic
1005926426 6:30449381-30449403 CTTCCTAGCCACCAGCTTCCTGG - Intergenic
1005928150 6:30461953-30461975 CTTCCTAGCCACCAGCTTCCTGG - Intergenic
1007854009 6:44835391-44835413 CTGCCCTGTCACCAAGAGCCTGG + Intronic
1009456049 6:63857837-63857859 CTTCCTTGTCAGCAAGCATCGGG + Intronic
1012453806 6:99382147-99382169 CTTCCTGAGCACCATGTTCCAGG - Intronic
1013292933 6:108734148-108734170 TTGCCTTTTCAACAAGTTCCAGG + Intergenic
1014756795 6:125310131-125310153 CTTCCTTGTCTCTAAGGCCCGGG + Intergenic
1016511998 6:144853658-144853680 CTACCTAGTCAACAAGTTGCTGG - Intergenic
1017431598 6:154376683-154376705 GTTCATGTTCACCAAGTTCCTGG - Intronic
1018347173 6:162912229-162912251 TTTCCTTGTGATCAACTTCCAGG + Intronic
1018445581 6:163855181-163855203 CTTCCTTGTCAAAAAGATCTGGG - Intergenic
1018928474 6:168223275-168223297 CTTCCTTGGGACCCAGTTCTGGG - Intergenic
1024031138 7:45460729-45460751 CTTTCTTGTTACCAAATTTCAGG - Intergenic
1024603502 7:51007316-51007338 CTTTCTTGTCAGAAAGATCCAGG - Intergenic
1028593787 7:92527330-92527352 AGTCACTGTCACCAAGTTCCAGG - Intronic
1032059810 7:128715165-128715187 CTGCTTTCTCAGCAAGTTCCGGG + Intronic
1032266322 7:130372562-130372584 CTCCCTTGTGACGAAATTCCAGG + Intergenic
1036598338 8:10235684-10235706 CTTCCTTCTCTCCAAAGTCCAGG + Intronic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1037434958 8:18852687-18852709 CTTCCTTGTGGCCAGGTTCCAGG - Intronic
1038198900 8:25393453-25393475 CTTCCATGGCTCCAAGTACCTGG + Intronic
1038534455 8:28343962-28343984 CTGCCTTTTTACCAAGCTCCAGG + Intergenic
1041530677 8:58862823-58862845 CTTTATTATCACCAAGTTACAGG - Intronic
1041890278 8:62860612-62860634 CTTCCTGCTAAACAAGTTCCTGG + Intronic
1045604875 8:103761508-103761530 CTTCCTTATCTCCAAGGTCTTGG + Intronic
1046566327 8:115905733-115905755 TTGCCTTGTCACCATATTCCTGG + Intergenic
1047067710 8:121304642-121304664 CTTTCTTGTCAACATGGTCCTGG - Intergenic
1047143550 8:122170433-122170455 CTTCCTAATCAGCAAGTACCAGG - Intergenic
1047273922 8:123390457-123390479 CTGCCATGTCACCCAATTCCAGG + Intronic
1048534114 8:135276516-135276538 TCTCCTTGTCACTGAGTTCCTGG - Intergenic
1050391481 9:5148354-5148376 GTTCTTAGTTACCAAGTTCCTGG + Intronic
1051265520 9:15306044-15306066 CTTCCTTGTCAGGAGATTCCTGG + Intronic
1053722341 9:40959385-40959407 CTTGTTTTTCACCAAGCTCCAGG - Intergenic
1054343628 9:63892613-63892635 CTTGTTTTTCACCAAGCTCCAGG + Intergenic
1056890273 9:90485501-90485523 CTTTCTTCTCAACAATTTCCAGG - Intergenic
1057169604 9:92953568-92953590 ATCCCTGGACACCAAGTTCCTGG - Intronic
1058051211 9:100408912-100408934 TTTCTTTGTCTCCAAGTTCTAGG - Intergenic
1059730994 9:117056719-117056741 CTTTCATTTCACCAACTTCCAGG - Intronic
1061806324 9:133139563-133139585 CTTCCCTGAGGCCAAGTTCCAGG - Intronic
1203452834 Un_GL000219v1:136595-136617 CTTTTTTTTCACCAAGCTCCAGG + Intergenic
1185912738 X:4000322-4000344 CTTCTTTGTCACCCAGTACATGG - Intergenic
1187067256 X:15853941-15853963 CTTTCTGGTCACCAAGATCTAGG - Intronic
1189853552 X:45200510-45200532 ATTCCTTTTCAACAAATTCCTGG + Intronic
1197609186 X:128619719-128619741 CTTCCTTGTCAACATTTTTCTGG - Intergenic
1200037535 X:153342742-153342764 CTTCCTGGTCACCCTTTTCCTGG + Intronic
1201938039 Y:19428489-19428511 TTTCCTTGTCACCATGTTTATGG - Intergenic