ID: 1000209547

View in Genome Browser
Species Human (GRCh38)
Location 5:159097234-159097256
Sequence AGCGCCCACTGGATGTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000209547_1000209556 19 Left 1000209547 5:159097234-159097256 CCCCAAAACATCCAGTGGGCGCT 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1000209556 5:159097276-159097298 ACATAGACCCAGCTGACAACGGG 0: 1
1: 0
2: 0
3: 7
4: 114
1000209547_1000209551 -6 Left 1000209547 5:159097234-159097256 CCCCAAAACATCCAGTGGGCGCT 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1000209551 5:159097251-159097273 GGCGCTCTTCACGCCCCTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1000209547_1000209555 18 Left 1000209547 5:159097234-159097256 CCCCAAAACATCCAGTGGGCGCT 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1000209555 5:159097275-159097297 GACATAGACCCAGCTGACAACGG 0: 1
1: 0
2: 1
3: 11
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000209547 Original CRISPR AGCGCCCACTGGATGTTTTG GGG (reversed) Intronic
901752888 1:11422427-11422449 AGGGCCCACTTGCTGTCTTGGGG - Intergenic
904892225 1:33788115-33788137 AGGGCCTTCTGGTTGTTTTGAGG - Intronic
908820294 1:68078784-68078806 AGAGCCACCTAGATGTTTTGTGG - Intergenic
914928629 1:151909806-151909828 CGCGCCGACTGGAGGCTTTGCGG + Exonic
915545857 1:156597336-156597358 AGAGAACACTGGATGCTTTGTGG + Intronic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
922336176 1:224619779-224619801 AGCGCCCAATTCATTTTTTGGGG - Intronic
1064338026 10:14461165-14461187 CTCCCCCACGGGATGTTTTGTGG + Intronic
1069646898 10:70006636-70006658 AATGCCTACTGGATATTTTGGGG - Intergenic
1072499431 10:95998390-95998412 AGAGCACACAGGATGTTTAGGGG - Intronic
1074777684 10:116778335-116778357 AGCACCAGCTGGAGGTTTTGGGG - Intergenic
1075087264 10:119421968-119421990 AGAGTCCACTGGATGGTTTCTGG - Intronic
1076291875 10:129351760-129351782 TGCTCCCACTGGAGGCTTTGGGG - Intergenic
1077051402 11:568530-568552 CGCGCCCACTGGCTGCGTTGCGG - Intergenic
1082774253 11:57233811-57233833 AGTGTTCACTGGATGCTTTGAGG + Exonic
1093259906 12:16923080-16923102 AGAGCCCACAGTATGTTTGGGGG + Intergenic
1095337670 12:41048220-41048242 TGGGCCCACTTGAAGTTTTGTGG - Intronic
1106324206 13:28672370-28672392 ATCTTTCACTGGATGTTTTGAGG + Exonic
1107389880 13:39952949-39952971 AGAGCCCAGTGTATGTTCTGTGG + Intergenic
1120886535 14:89456219-89456241 AGGGCCCACGGGCTCTTTTGTGG - Intronic
1121602805 14:95218606-95218628 AGGGCCCACTGAGTATTTTGTGG + Intronic
1122267564 14:100553842-100553864 CGCGCCCTCTGGCTGTCTTGTGG - Intronic
1123203647 14:106691895-106691917 AGCGCCCCCTGCAGGTTCTGAGG + Intergenic
1127577631 15:60307511-60307533 TGAGCCCACTGGAGGTTTTGAGG + Intergenic
1129096382 15:73213164-73213186 AGCAACCACTGGAGGTTTTCAGG + Intronic
1131179556 15:90230641-90230663 AGCTCCCTCTGGATGTCTCGGGG - Intronic
1132702333 16:1227160-1227182 CACGCCCACTGGAGGTTTTGCGG - Intergenic
1132705992 16:1243708-1243730 CACGCCCACTGGAGGTTTTGCGG + Intergenic
1134012742 16:10867305-10867327 AGAGCCCACTGTGTGTGTTGGGG + Intergenic
1136872099 16:33816724-33816746 AGCGCCCCCTGGTGGTTCTGAGG - Intergenic
1137622333 16:49884086-49884108 AGGTCCCTCTGGCTGTTTTGTGG - Intergenic
1137955537 16:52825285-52825307 AGATCACTCTGGATGTTTTGTGG - Intergenic
1138454926 16:57115712-57115734 AGCCCCCACTGCATCATTTGTGG - Intronic
1138565153 16:57827706-57827728 TGTGCCCACTGGAGGGTTTGTGG - Intronic
1141649827 16:85386943-85386965 AGCTCCCACTGAAGGTTCTGGGG + Intergenic
1203100073 16_KI270728v1_random:1299344-1299366 AGCGCCCCCTGGTGGTTCTGAGG + Intergenic
1146072461 17:29695846-29695868 AGCACCCACTGGCTGTTTTTGGG + Intronic
1151694619 17:75707827-75707849 AGGGCACTGTGGATGTTTTGTGG + Exonic
1161944545 19:7427147-7427169 GGCGCACACAGGATGTTTTAGGG + Intronic
1163720809 19:18897323-18897345 AGGGCCACCTGGATGTGTTGTGG - Intergenic
930341727 2:50124596-50124618 AGGGCACAATGGAAGTTTTGGGG - Intronic
931639005 2:64364788-64364810 AGCTCCCACTGGCTGTGTTCAGG + Intergenic
931942469 2:67267651-67267673 AGCCCCCACTTGCTTTTTTGGGG - Intergenic
933599925 2:84318719-84318741 AGCTCCCAGTGTGTGTTTTGAGG - Intergenic
937285023 2:120745274-120745296 AGCGCCATCAGGATGCTTTGTGG + Intronic
939204581 2:139084027-139084049 AGCCCCCTCTGGCAGTTTTGTGG + Intergenic
939782504 2:146465751-146465773 AGAGCCACCTGGATGTTTTACGG - Intergenic
1181161317 22:20961641-20961663 AGCACCCACTGGATTCTTTGGGG - Intergenic
1181627992 22:24134296-24134318 CGGGCCCACTGGAGGTTCTGGGG - Exonic
1182148601 22:28013015-28013037 AGTGCCCTCTGGATGTTCTCTGG - Intronic
1183548010 22:38465636-38465658 AGCCCCCACTGTGTGTGTTGGGG - Intergenic
955472200 3:59297630-59297652 AGAGCCACCTGGATGTTTTATGG - Intergenic
960821562 3:121738536-121738558 AATGCCCACTGGCTCTTTTGAGG - Intronic
968062587 3:195737345-195737367 AGAGCCCACTGAAAGTTTCGGGG - Intronic
970070489 4:12154221-12154243 TGCACCCATTGTATGTTTTGTGG + Intergenic
979082762 4:116363183-116363205 AGCAGCCACTGGATGTCTTTTGG - Intergenic
979654998 4:123181688-123181710 TTGGCCCACTGGCTGTTTTGGGG + Intronic
981516926 4:145619501-145619523 GGCGCCCCCTGGAGGATTTGGGG + Intronic
986609281 5:9550861-9550883 AGGGCCCACTGGATGCTTGATGG - Intergenic
987374419 5:17219632-17219654 AACGCCCACTGACAGTTTTGAGG - Intronic
992529294 5:77639343-77639365 AGCGCCCGCTGTCTGCTTTGGGG + Exonic
995741536 5:115360757-115360779 AGTGCCCAAGCGATGTTTTGAGG + Intergenic
996411456 5:123163682-123163704 ATCCCCCACTGGAAGCTTTGGGG - Intronic
1000173729 5:158729299-158729321 AGAGTCCACTGGAGGTATTGAGG - Intronic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1001465187 5:171957859-171957881 AGGGCCCACTTGATGTTCTATGG + Intronic
1003720867 6:8700797-8700819 AGGTCACTCTGGATGTTTTGGGG - Intergenic
1004588124 6:17022453-17022475 AGAGCACAGAGGATGTTTTGAGG - Intergenic
1007631243 6:43274807-43274829 GACGCCCACTGGATGGTGTGTGG - Intronic
1008478250 6:51956940-51956962 AGATTCCACTGGAGGTTTTGAGG + Intronic
1016216686 6:141612718-141612740 AGTGCCCAGTGTATGTTCTGAGG + Intergenic
1017151090 6:151281465-151281487 AGTGCCCACTTTATCTTTTGAGG + Intronic
1021001169 7:15331992-15332014 ATTGCCCATTGGAGGTTTTGGGG - Intronic
1022529245 7:31056907-31056929 AGCGCCCCCTGGATGGATTTGGG - Intronic
1027133636 7:75609264-75609286 AGAGCCCACTCTATGGTTTGGGG + Intronic
1037295162 8:17391838-17391860 AACCCCCACTTAATGTTTTGTGG - Intronic
1042518108 8:69681170-69681192 ACCATCCACTGAATGTTTTGGGG - Intronic
1045582718 8:103499092-103499114 AGCGACCACTGGAGGCTGTGAGG - Intergenic
1047453483 8:124988202-124988224 AGTGACCACAGGATGGTTTGGGG - Intergenic
1048101720 8:131359240-131359262 AGAGCCACCTGGATGTTTTATGG - Intergenic
1059237682 9:112776115-112776137 AGGGCCCACTGGATTTTGAGTGG - Intronic
1186480397 X:9892386-9892408 AGAGCCCAGTGTATTTTTTGGGG + Intronic
1186834381 X:13422836-13422858 TGTGCTCACTTGATGTTTTGGGG - Intergenic
1187287008 X:17915351-17915373 AATGCCCACTTAATGTTTTGTGG - Intergenic