ID: 1000209551

View in Genome Browser
Species Human (GRCh38)
Location 5:159097251-159097273
Sequence GGCGCTCTTCACGCCCCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000209549_1000209551 -8 Left 1000209549 5:159097236-159097258 CCAAAACATCCAGTGGGCGCTCT 0: 1
1: 0
2: 1
3: 6
4: 60
Right 1000209551 5:159097251-159097273 GGCGCTCTTCACGCCCCTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1000209539_1000209551 17 Left 1000209539 5:159097211-159097233 CCTCAAACACCCACCTCCTCTTC 0: 1
1: 0
2: 4
3: 56
4: 707
Right 1000209551 5:159097251-159097273 GGCGCTCTTCACGCCCCTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1000209541_1000209551 7 Left 1000209541 5:159097221-159097243 CCACCTCCTCTTCCCCCAAAACA 0: 1
1: 1
2: 11
3: 143
4: 1852
Right 1000209551 5:159097251-159097273 GGCGCTCTTCACGCCCCTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1000209543_1000209551 1 Left 1000209543 5:159097227-159097249 CCTCTTCCCCCAAAACATCCAGT 0: 1
1: 0
2: 1
3: 33
4: 348
Right 1000209551 5:159097251-159097273 GGCGCTCTTCACGCCCCTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1000209540_1000209551 8 Left 1000209540 5:159097220-159097242 CCCACCTCCTCTTCCCCCAAAAC 0: 1
1: 0
2: 6
3: 67
4: 742
Right 1000209551 5:159097251-159097273 GGCGCTCTTCACGCCCCTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1000209538_1000209551 18 Left 1000209538 5:159097210-159097232 CCCTCAAACACCCACCTCCTCTT 0: 1
1: 0
2: 5
3: 60
4: 395
Right 1000209551 5:159097251-159097273 GGCGCTCTTCACGCCCCTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1000209546_1000209551 -5 Left 1000209546 5:159097233-159097255 CCCCCAAAACATCCAGTGGGCGC 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1000209551 5:159097251-159097273 GGCGCTCTTCACGCCCCTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1000209548_1000209551 -7 Left 1000209548 5:159097235-159097257 CCCAAAACATCCAGTGGGCGCTC 0: 1
1: 0
2: 1
3: 6
4: 72
Right 1000209551 5:159097251-159097273 GGCGCTCTTCACGCCCCTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1000209542_1000209551 4 Left 1000209542 5:159097224-159097246 CCTCCTCTTCCCCCAAAACATCC 0: 1
1: 2
2: 7
3: 96
4: 930
Right 1000209551 5:159097251-159097273 GGCGCTCTTCACGCCCCTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1000209547_1000209551 -6 Left 1000209547 5:159097234-159097256 CCCCAAAACATCCAGTGGGCGCT 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1000209551 5:159097251-159097273 GGCGCTCTTCACGCCCCTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000209551 Original CRISPR GGCGCTCTTCACGCCCCTTC AGG Intronic
900507826 1:3038591-3038613 GGCGCTCGTCCCGCCCCACCTGG + Intergenic
901957302 1:12795852-12795874 GGAGATCTTCACCCCACTTCGGG + Exonic
901965321 1:12861635-12861657 GGAGATCTTCACCCCACTTCGGG + Exonic
901977325 1:13005465-13005487 GGAGCTCCTCACCCCACTTCAGG + Intronic
901988719 1:13095296-13095318 GGAGATCTTCACCCCACTTCGGG - Intergenic
901993094 1:13131471-13131493 GGAGATCTTCACCCCACTTCGGG + Intergenic
902001375 1:13196945-13196967 GGAGATCTTCACCCCACTTCGGG - Exonic
902004761 1:13223469-13223491 GGAGCTCCTCACCCCACTTCAGG - Intergenic
902023979 1:13369204-13369226 GGAGCTCCTCACCCCACTTCAGG - Exonic
902780029 1:18698995-18699017 GGCGGCCTTCACCCCCCATCAGG + Intronic
904536391 1:31202211-31202233 GGGGCTCTGCAAGCCCCTTCTGG + Intronic
920002849 1:202811349-202811371 GGCGCTCCTCGCGTTCCTTCCGG + Intergenic
923402267 1:233626436-233626458 GGCCCTCATCACGCCCCATTAGG - Intronic
1069673664 10:70232454-70232476 GGCGCCCTCCACGCTCCTTAGGG - Intronic
1081502569 11:43680911-43680933 CTCGCTCTTCACGGCCCTCCGGG + Exonic
1081973294 11:47214852-47214874 GGCGCAGTTCCCGCCCCTCCCGG + Intronic
1084224380 11:67706526-67706548 TGTCCTCTTCACACCCCTTCTGG + Intergenic
1084351313 11:68601963-68601985 GCCTCTCTGCACGCACCTTCTGG - Exonic
1086993720 11:93332972-93332994 GGCGCTAGTCACACCACTTCAGG + Intronic
1089826538 11:121282983-121283005 AGGCCTCTTCAGGCCCCTTCAGG - Intergenic
1092919369 12:13217357-13217379 GGCAATCTTCCAGCCCCTTCTGG + Exonic
1094470374 12:30796593-30796615 GGCTCTCCTCCCGCCCCTCCCGG + Intergenic
1099396991 12:82152441-82152463 TGCGCTCTTCAAGCACCTTCTGG - Intergenic
1100405800 12:94272084-94272106 GGCCCTCTTCCCGGGCCTTCTGG + Intronic
1103373566 12:120437921-120437943 TGCGCTCTGCACCTCCCTTCAGG - Intergenic
1103775454 12:123364100-123364122 GGCTCCCTTCACGCCTCTCCAGG - Intronic
1104443526 12:128814785-128814807 GGCGCTCTCCACTTCGCTTCTGG + Exonic
1114735255 14:25037103-25037125 GGAGCTCTTCAGGGCCTTTCAGG - Intronic
1117283536 14:54264266-54264288 GGAGCTTTCCACGCCTCTTCTGG - Intergenic
1122645197 14:103189349-103189371 GGGGCTCTCCGCGCTCCTTCTGG + Intergenic
1123030526 14:105449212-105449234 GGTGGTCTTCACGCCCCACCGGG + Intronic
1126773526 15:52080293-52080315 GGAGCTCGGCACGCCCCTTGAGG + Intergenic
1131601149 15:93850324-93850346 GGCACTGTTCATGCTCCTTCTGG - Intergenic
1132234454 15:100208555-100208577 GGGCCTCTTCATGCCCCTTCTGG - Intronic
1132591512 16:728248-728270 GGCGCCCTCCCCGCCCCTCCCGG - Intronic
1142293352 16:89202608-89202630 GCCGCTCTCCGCGCCCCTCCAGG + Intergenic
1142299539 16:89248338-89248360 GCCGCTCTCCGCGCCCCTCCCGG + Intergenic
1144345801 17:14348159-14348181 GGAGCTTTTCCCTCCCCTTCAGG + Exonic
1154332313 18:13440175-13440197 GGCGCTCCACAGGCCTCTTCTGG + Intronic
1159098984 18:63937499-63937521 GGTGCTCTTCACACACCCTCTGG + Intergenic
1164685977 19:30167200-30167222 GGGGCACTACAAGCCCCTTCTGG - Intergenic
934219548 2:90069503-90069525 AGCGCCCTCCCCGCCCCTTCGGG - Intergenic
937237396 2:120438919-120438941 GCCCCTCTTCACGGTCCTTCAGG + Intergenic
940858112 2:158745534-158745556 GGCGCACTTCACCTCCCTCCTGG + Intergenic
942046334 2:172101426-172101448 CGCGCTCTCCTCGCCCCTGCAGG + Intronic
945649111 2:212537992-212538014 GCCGCTCTCCACCGCCCTTCGGG + Intronic
948672521 2:239577647-239577669 GCCTCTCTCCACGTCCCTTCAGG - Intergenic
1171417476 20:24992806-24992828 AGCGTTCTCCCCGCCCCTTCCGG + Exonic
1175418654 20:58817605-58817627 AGCGCTCTTCAGAGCCCTTCAGG + Intergenic
1179808680 21:43856232-43856254 GGCCCTCATCACGCCCCCACAGG + Intergenic
1181028194 22:20137643-20137665 GGAGCTCTCCACGAGCCTTCTGG - Intronic
1182453663 22:30435904-30435926 GGCGCACTTCCTGCCCCTGCTGG + Intergenic
950479153 3:13234020-13234042 CGCGCTCTGCATGCCACTTCCGG + Intergenic
951666030 3:25124519-25124541 GTCCCTCTTCACACCCTTTCTGG + Intergenic
971363001 4:25953996-25954018 GGAACTCTGCACGCCCCTGCAGG + Intergenic
980486328 4:133461819-133461841 GGCTGTCATCACGCCCTTTCTGG + Intergenic
985678344 5:1243692-1243714 GGCGGTCATCACACCCCTGCTGG + Exonic
1000209551 5:159097251-159097273 GGCGCTCTTCACGCCCCTTCAGG + Intronic
1007464741 6:42043946-42043968 GGGGCTCCTGAGGCCCCTTCCGG + Intronic
1019159311 6:170058460-170058482 AGGCCTCTCCACGCCCCTTCAGG - Intergenic
1019365816 7:632294-632316 GGTGGTCTCCACGCCCCTTGAGG - Intronic
1034584400 7:152076400-152076422 GGCGCACTTCATTCCCCTACTGG - Intronic
1038307968 8:26421691-26421713 ATCTCTCTTCACTCCCCTTCAGG - Intronic
1049610822 8:143553956-143553978 TGGGCTCTTCACACCCCTGCTGG + Intronic
1049803573 8:144529040-144529062 GGCGCTCTTCCCTCTCCCTCGGG + Exonic
1197623674 X:128780027-128780049 GGCGCTTTTCTCTCCCCTTCAGG + Intergenic