ID: 1000209555

View in Genome Browser
Species Human (GRCh38)
Location 5:159097275-159097297
Sequence GACATAGACCCAGCTGACAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 247}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000209548_1000209555 17 Left 1000209548 5:159097235-159097257 CCCAAAACATCCAGTGGGCGCTC 0: 1
1: 0
2: 1
3: 6
4: 72
Right 1000209555 5:159097275-159097297 GACATAGACCCAGCTGACAACGG 0: 1
1: 0
2: 1
3: 11
4: 247
1000209550_1000209555 7 Left 1000209550 5:159097245-159097267 CCAGTGGGCGCTCTTCACGCCCC 0: 1
1: 0
2: 0
3: 1
4: 78
Right 1000209555 5:159097275-159097297 GACATAGACCCAGCTGACAACGG 0: 1
1: 0
2: 1
3: 11
4: 247
1000209543_1000209555 25 Left 1000209543 5:159097227-159097249 CCTCTTCCCCCAAAACATCCAGT 0: 1
1: 0
2: 1
3: 33
4: 348
Right 1000209555 5:159097275-159097297 GACATAGACCCAGCTGACAACGG 0: 1
1: 0
2: 1
3: 11
4: 247
1000209547_1000209555 18 Left 1000209547 5:159097234-159097256 CCCCAAAACATCCAGTGGGCGCT 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1000209555 5:159097275-159097297 GACATAGACCCAGCTGACAACGG 0: 1
1: 0
2: 1
3: 11
4: 247
1000209542_1000209555 28 Left 1000209542 5:159097224-159097246 CCTCCTCTTCCCCCAAAACATCC 0: 1
1: 2
2: 7
3: 96
4: 930
Right 1000209555 5:159097275-159097297 GACATAGACCCAGCTGACAACGG 0: 1
1: 0
2: 1
3: 11
4: 247
1000209549_1000209555 16 Left 1000209549 5:159097236-159097258 CCAAAACATCCAGTGGGCGCTCT 0: 1
1: 0
2: 1
3: 6
4: 60
Right 1000209555 5:159097275-159097297 GACATAGACCCAGCTGACAACGG 0: 1
1: 0
2: 1
3: 11
4: 247
1000209546_1000209555 19 Left 1000209546 5:159097233-159097255 CCCCCAAAACATCCAGTGGGCGC 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1000209555 5:159097275-159097297 GACATAGACCCAGCTGACAACGG 0: 1
1: 0
2: 1
3: 11
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000209555 Original CRISPR GACATAGACCCAGCTGACAA CGG Intronic
902138392 1:14330996-14331018 GCCACAGACCCAGCTAACAGGGG - Intergenic
902667145 1:17947512-17947534 GACATAGACCAAGATGACTGTGG + Intergenic
903891190 1:26571710-26571732 GACCTTGGCCCAGCTGGCAAGGG + Intronic
907944188 1:59118306-59118328 GTCATAGACAAATCTGACAAAGG - Intergenic
909490663 1:76222768-76222790 GACATGCAAACAGCTGACAAGGG + Intronic
910384066 1:86662688-86662710 GCAATATACCCATCTGACAAAGG + Intergenic
910689625 1:89952839-89952861 GGCATAGACCAAGCTAACCATGG + Intergenic
914197594 1:145456898-145456920 GTTATAGACACAGTTGACAAGGG - Intergenic
914476698 1:148030010-148030032 GTTATAGACACAGTTGACAAGGG - Intergenic
915383519 1:155467073-155467095 GTCATAGAACAAGCAGACAATGG - Intronic
917812344 1:178671628-178671650 GAAATAGCCCCATCTGCCAATGG + Intergenic
919437072 1:197575178-197575200 GCCATCTACCCATCTGACAAAGG + Intronic
920556057 1:206905415-206905437 GAAAGAGACCCAGCTGCCAGAGG + Intronic
921103568 1:211952990-211953012 GACATAAACACATCTGAAAAGGG + Intronic
921339239 1:214117982-214118004 AACATTGAACCAGCTGGCAAAGG - Intergenic
922151758 1:223011750-223011772 GACAGGGAATCAGCTGACAAAGG - Intergenic
923467952 1:234265829-234265851 GACAGAGACCCAGCTGAGAAGGG - Intronic
923908146 1:238408975-238408997 GACATGGACCAAGCTGACTTTGG + Intergenic
1063092473 10:2879542-2879564 GACAGAAACCCAGCTAACACTGG - Intergenic
1066043174 10:31572871-31572893 GCCAAAGACCCACCTGATAAAGG + Intergenic
1067566723 10:47344704-47344726 TACACAGACACAGGTGACAATGG + Intergenic
1070777369 10:79117749-79117771 TACAAAGACCCAGCTGAAGATGG + Intronic
1070858341 10:79628125-79628147 CCCATAGACCCAGAAGACAAAGG - Intergenic
1070971316 10:80569764-80569786 CACATAGGCCGAGCTAACAATGG - Intronic
1071018397 10:81024476-81024498 GCCATCTACCCATCTGACAAAGG + Intergenic
1071508910 10:86249234-86249256 GACATAGGTCCTGCTGCCAAGGG - Intronic
1072402415 10:95118579-95118601 GCAATATACCCATCTGACAAAGG - Intergenic
1074545126 10:114396222-114396244 GACACAGACCCAGCTTCCCAGGG + Intronic
1075470083 10:122682117-122682139 GAGATAGAAACAGATGACAAAGG + Intergenic
1076740367 10:132479852-132479874 GACAGAGAACGAGCTGACTATGG + Intergenic
1076886213 10:133263773-133263795 GAAACAGACACAGCTGACATGGG + Intronic
1077308849 11:1879696-1879718 GACCTAGACCCAGGTGACCCTGG - Intronic
1077722787 11:4644554-4644576 GACACAGACCAAGCTGAGATCGG - Intronic
1079342073 11:19619662-19619684 GCAATATACCCATCTGACAAAGG - Intronic
1079608849 11:22405358-22405380 GAAATCTACCCATCTGACAAAGG + Intergenic
1083358772 11:62090040-62090062 GTCAAAGACACAGTTGACAAGGG - Intergenic
1083650571 11:64201645-64201667 GACACAGACCCAGAAGACAGTGG - Intronic
1085963855 11:81497193-81497215 GACGTAGACATAGCTGAGAAAGG + Intergenic
1085999210 11:81958918-81958940 GTCTTGTACCCAGCTGACAATGG + Intergenic
1086350419 11:85938276-85938298 GGCATAGGCCAAGCTAACAATGG - Intergenic
1090191340 11:124771369-124771391 GACATGGAATCAGATGACAATGG + Intronic
1091671534 12:2455640-2455662 GACAAACACCCAGCAGACATAGG - Intronic
1091861715 12:3791443-3791465 AACATGGAGCCAGCTGGCAAAGG - Intronic
1092029412 12:5271597-5271619 TACATAGACCCAGGAGACTAAGG + Intergenic
1094099031 12:26741408-26741430 GACTTGTACCCAGCTGGCAAAGG - Intronic
1094288343 12:28818359-28818381 GACATAGTCACAGCTGCCCATGG + Intergenic
1097922917 12:65096107-65096129 GCAATATACCCATCTGACAAAGG + Intronic
1098909457 12:76194235-76194257 CACATAGACCAAGCTAACTATGG + Intergenic
1099820719 12:87705903-87705925 GCAATCTACCCAGCTGACAAAGG + Intergenic
1100399242 12:94213554-94213576 GCAATCTACCCAGCTGACAAAGG - Intronic
1100612394 12:96202320-96202342 GACAAAGACCCAGTGGACAGAGG - Intronic
1101066025 12:101021449-101021471 AACATTGAATCAGCTGACAAAGG + Intronic
1103095498 12:118129076-118129098 GCCATCTACCCATCTGACAAAGG + Intronic
1103404893 12:120668194-120668216 GATATAGACACAGCTGCCACTGG + Intergenic
1107341847 13:39415651-39415673 GACACTGCCCCAGCTGCCAAGGG - Intronic
1108170799 13:47739968-47739990 GCCATCTACCCACCTGACAAAGG + Intergenic
1109216519 13:59595862-59595884 GCAATCTACCCAGCTGACAAAGG + Intergenic
1109515309 13:63436195-63436217 GACATAGGCCAAGCTAACCATGG - Intergenic
1109816674 13:67593558-67593580 GTCATCTACCCATCTGACAAAGG + Intergenic
1112083964 13:96008276-96008298 GACAAATACCCATCTGACAAGGG + Intronic
1114210071 14:20606654-20606676 GACATAGTCGCAGCTGCCCAAGG + Intronic
1115708616 14:36025479-36025501 GCCAATGACCCATCTGACAAGGG - Intergenic
1117173117 14:53121031-53121053 GAAATCTACCCACCTGACAAAGG + Intronic
1118637517 14:67761339-67761361 GACATGGACACAGCTCAAAAAGG - Intronic
1119391276 14:74292787-74292809 TCCATAGACCCCGCTGAAAATGG + Exonic
1119840697 14:77790697-77790719 GCCATACCCCCAGCTGTCAATGG - Intergenic
1120323090 14:82990831-82990853 GCCATACACACATCTGACAAAGG + Intergenic
1121161766 14:91749631-91749653 GCAATATACCCATCTGACAAAGG + Intronic
1121446974 14:93985005-93985027 GGCATGGGCCAAGCTGACAAAGG + Intergenic
1126002716 15:44226619-44226641 GAAATCTACCCATCTGACAAAGG + Intergenic
1126128714 15:45320030-45320052 GACATAGGCCAAGCTAACTATGG + Intergenic
1127687235 15:61360034-61360056 GATATCTACCCATCTGACAAAGG - Intergenic
1128160489 15:65420556-65420578 GAGCTAGATCCAGCTCACAAAGG - Intronic
1129678718 15:77646110-77646132 AACAGACACCCAGCTGCCAAGGG + Intronic
1130168679 15:81488643-81488665 GCAATCTACCCAGCTGACAAAGG - Intergenic
1130180992 15:81628312-81628334 GAAATCTACCCATCTGACAAAGG + Intergenic
1131182623 15:90250823-90250845 GTCATAGCCCCAGTTGACACAGG + Exonic
1133476681 16:6128950-6128972 GAAACAGACCCACCTGACAAAGG + Intronic
1134988003 16:18672339-18672361 GCCATCTACCCATCTGACAAAGG + Intergenic
1135204016 16:20467009-20467031 GACATAGTCCAAGCTAACTATGG - Intronic
1135214984 16:20557914-20557936 GACATAGTCCAAGCTAACTATGG + Intronic
1137035309 16:35564947-35564969 TACCTAGACCCAGCCTACAAGGG - Intergenic
1139366987 16:66439526-66439548 GAGATGGACCCAGCTTCCAATGG - Intronic
1141310792 16:82911746-82911768 GACCTAGGCTCAGCAGACAATGG - Intronic
1141330406 16:83105792-83105814 GACATACACACACATGACAATGG - Intronic
1142088177 16:88195644-88195666 GGCATGGGCCCAGCTAACAATGG + Intergenic
1142954227 17:3510064-3510086 GCCATCTACCCATCTGACAAAGG - Intronic
1143199045 17:5099330-5099352 GCGACATACCCAGCTGACAAAGG - Intergenic
1147320586 17:39643496-39643518 GACACAGATCCAGCTGGCCATGG - Intronic
1149338613 17:55663561-55663583 CACTTAGACCCAGATGACTAAGG - Intergenic
1149962362 17:61124911-61124933 GAAATAGATACAGGTGACAATGG + Intronic
1150437629 17:65166274-65166296 GACATAGACACATCTGTCAATGG + Intronic
1153954136 18:10081654-10081676 GAGATAAAGCCAGCTGTCAAAGG - Intergenic
1154363819 18:13688349-13688371 GACTCAGACTCAGCTGACAGAGG + Intronic
1154969571 18:21393910-21393932 GACAGAAACCCAACTGAAAATGG + Intronic
1155408746 18:25518622-25518644 GACATATACCCTACTGATAAGGG - Intergenic
1156205553 18:34882247-34882269 GTCAAAGACCCAGCTACCAAGGG - Intronic
1156230272 18:35147067-35147089 GCAATATACCCATCTGACAAAGG - Intergenic
1157336934 18:46747309-46747331 GCCATCTACCCATCTGACAAAGG + Intronic
1157631595 18:49103314-49103336 GCCATCTACCCATCTGACAAGGG - Intronic
1157639440 18:49198470-49198492 GCCATCTACCCATCTGACAAGGG + Intronic
1157845790 18:51002780-51002802 GAAATCTACCCATCTGACAAAGG + Intronic
1158085200 18:53642858-53642880 GCCATCTACCCATCTGACAAAGG + Intergenic
1158792435 18:60798071-60798093 GCCATCTACCCATCTGACAAAGG - Intergenic
1159846699 18:73469670-73469692 GAAATCTACCCATCTGACAAAGG - Intergenic
1161953830 19:7482179-7482201 GACGGAGACACAGCGGACAAAGG + Exonic
1162791543 19:13065592-13065614 GACAAAGGCCCACCTGCCAATGG - Intronic
1164110564 19:22153602-22153624 GAAATCTACCCATCTGACAAAGG + Intergenic
1164972584 19:32545179-32545201 GACCTGGACCCAGCTGCCCATGG - Intergenic
1166161249 19:40955141-40955163 CACACAGACCAAGCAGACAAGGG - Intergenic
1166697955 19:44864871-44864893 CACCTAGACCCACTTGACAATGG + Intronic
1167896981 19:52589875-52589897 CACTTAAACCCAGGTGACAAAGG - Intergenic
1168384227 19:55949616-55949638 AACATAGACCCTGCAGAGAAGGG + Intronic
926207126 2:10841704-10841726 AACATTGCACCAGCTGACAAAGG + Intergenic
926262792 2:11282838-11282860 GAAAAACACCCACCTGACAAAGG + Intronic
927610301 2:24532354-24532376 GCAATATACCCATCTGACAAAGG - Intronic
928028856 2:27761846-27761868 GACATAGATCCATTTGAAAATGG + Intergenic
928757218 2:34541889-34541911 GCCATCTACCCATCTGACAAAGG - Intergenic
929830857 2:45345194-45345216 GACTGAGGCACAGCTGACAAGGG - Intergenic
931412476 2:62046060-62046082 GACATAGGCCAAGCTGACATTGG - Intronic
935932910 2:108148627-108148649 CACATAGACCCTGCTGAGAGAGG - Intergenic
936176497 2:110227033-110227055 GAAATCTACCCATCTGACAAAGG - Intergenic
936677473 2:114731830-114731852 GACTTAGAGCAAGCAGACAAGGG + Intronic
936728695 2:115355458-115355480 GCAATATACCCATCTGACAAAGG - Intronic
936923429 2:117712405-117712427 GACATAGAGCAAGCTGAGAACGG + Intergenic
940075143 2:149732935-149732957 GGCATAGACCAAGCTAACCAAGG - Intergenic
940383583 2:153044594-153044616 GAAATCTACCCATCTGACAAAGG - Intergenic
943296548 2:186147543-186147565 GCAATATACCCATCTGACAAAGG + Intergenic
943866086 2:192926070-192926092 GCAATATACCCACCTGACAAAGG - Intergenic
944240523 2:197481208-197481230 GACATAGACCTTGCTGCCACAGG + Intergenic
944935023 2:204559281-204559303 GAAATCTACCCATCTGACAAAGG + Intronic
946773840 2:223117045-223117067 GACATAGACCCTGCCGTCATGGG + Intronic
948115236 2:235490534-235490556 GACAGAGAAGCAGATGACAAGGG + Intergenic
1168869514 20:1116503-1116525 GGCACAGGGCCAGCTGACAAAGG + Intronic
1169172994 20:3480613-3480635 GAGGTAGAGCCAGCTGACTAGGG + Intronic
1169720211 20:8667932-8667954 CTCCTAGACCCTGCTGACAAGGG - Intronic
1174923028 20:54725191-54725213 GCAATCTACCCAGCTGACAAAGG - Intergenic
1175574935 20:60053843-60053865 GACAAAGACCTAGCTCACAAGGG + Intergenic
1180980466 22:19875913-19875935 GAAATAAACCCAGCAGAGAATGG + Intronic
1181153103 22:20899323-20899345 GTCATAGACCCAGCTAAGACAGG + Intergenic
1184154094 22:42655796-42655818 GACAGACACCAAGCTGAAAACGG + Intergenic
951164002 3:19462543-19462565 GCCATCTACCCACCTGACAAAGG - Intronic
953080828 3:39615897-39615919 GCCATCTACCCATCTGACAAAGG - Intergenic
953810890 3:46111974-46111996 GACATAATCCCAGCAGAAAAAGG - Intergenic
954954918 3:54510567-54510589 GACAGTGACCCAGGTGAAAAGGG - Intronic
957330781 3:78760240-78760262 GACAAAGACATAGCTGAGAATGG - Intronic
958037445 3:88187171-88187193 GCCATCTACCCATCTGACAAAGG + Intergenic
959152916 3:102629163-102629185 GGCATAGGCCAAGCTAACAATGG + Intergenic
959365503 3:105452974-105452996 GAAATCTACCCACCTGACAAAGG - Intronic
959954201 3:112216445-112216467 GCAATATACCCATCTGACAAAGG + Intronic
960523143 3:118679007-118679029 GCAATATACCCATCTGACAAAGG - Intergenic
960937877 3:122914256-122914278 GACATGGCCCCATCTCACAAGGG + Intronic
961200309 3:125040318-125040340 GACAGAGACGCAGATGACAAGGG + Intronic
962227789 3:133630707-133630729 CCTATAGTCCCAGCTGACAAGGG - Intronic
963344761 3:144081986-144082008 GAAATCTACCCATCTGACAAAGG + Intergenic
964010641 3:151887618-151887640 GGCATAGACCAAGCTGACTTTGG - Intergenic
964011616 3:151898753-151898775 GGCATAGACCAAGCTGACTTTGG + Intergenic
964154661 3:153570381-153570403 GCAATATACCCATCTGACAAAGG + Intergenic
964486636 3:157191927-157191949 GAAATCTACCCATCTGACAAAGG - Intergenic
964712161 3:159682711-159682733 GAAATAACCCCAGCTGCCAAGGG - Intronic
965436854 3:168663070-168663092 AACATAGTGCCTGCTGACAAAGG + Intergenic
969178530 4:5419328-5419350 GACAGAGACCCTACAGACAAAGG - Intronic
969865109 4:10070575-10070597 GAAAGATGCCCAGCTGACAATGG + Intergenic
970509853 4:16771027-16771049 AACATAAACACAGCAGACAAGGG + Intronic
974711814 4:65607414-65607436 GAAATCTACCCATCTGACAAAGG + Intronic
974968381 4:68794105-68794127 GCAATCTACCCAGCTGACAAAGG - Intergenic
975750645 4:77519616-77519638 GCAATTGACCCATCTGACAAAGG - Intronic
976262176 4:83156073-83156095 GGCATAGGCCAAGCTGACTATGG + Intergenic
978414256 4:108458919-108458941 AACAGAGAACGAGCTGACAAAGG + Intergenic
978676124 4:111318357-111318379 GACAAAAACACAGCTCACAAAGG + Intergenic
979358094 4:119729380-119729402 GAAATAGACCAAGCTAACTATGG - Intergenic
980426075 4:132629601-132629623 GACATCTACCCAACTGACAAAGG + Intergenic
983573603 4:169236338-169236360 CTCAGAGACCCAGCCGACAAAGG - Intronic
985928314 5:3035012-3035034 GACATGAACCCACCTGGCAAGGG - Intergenic
986592079 5:9381389-9381411 AACATAGATCCAGCTCTCAATGG - Intronic
987180362 5:15361343-15361365 GCCATCTACCCATCTGACAAAGG + Intergenic
988217961 5:28301436-28301458 GACATAGACCAAACTAACAATGG + Intergenic
991199215 5:63971575-63971597 GCAATATACCCATCTGACAAAGG - Intergenic
991264008 5:64695554-64695576 GACACAGACACTGATGACAAAGG - Exonic
992180356 5:74190535-74190557 GAAAAAGACACAGCTGATAAAGG - Intergenic
993290468 5:86061819-86061841 GCAATATACCCATCTGACAAAGG + Intergenic
993399183 5:87427640-87427662 GCCATATATCCATCTGACAAAGG - Intergenic
993955358 5:94226102-94226124 GCCATCTACCCATCTGACAAAGG + Intronic
994756633 5:103801137-103801159 GACATGAAACCAGATGACAATGG - Intergenic
996229326 5:121041653-121041675 GCAATATACCCATCTGACAAAGG - Intergenic
996768008 5:127054638-127054660 GCAATCTACCCAGCTGACAAAGG - Intronic
998104974 5:139462666-139462688 GCCACATACCCAGCTGACATGGG - Exonic
998284838 5:140849621-140849643 GACCTAGACGCAGATGCCAACGG + Exonic
998789353 5:145749209-145749231 GAAATCTACCCATCTGACAAAGG + Intronic
999109948 5:149110464-149110486 GACATAGACCCTGCTTGCATGGG + Intergenic
1000209555 5:159097275-159097297 GACATAGACCCAGCTGACAACGG + Intronic
1000523890 5:162331541-162331563 GAAATCTACCCATCTGACAAAGG + Intergenic
1001921817 5:175606492-175606514 GACATATACTGAGCTGACTATGG - Intergenic
1003770567 6:9294589-9294611 GCCATCTACCCATCTGACAAAGG - Intergenic
1004181969 6:13388852-13388874 GAAATCTACCCATCTGACAAAGG + Intronic
1004205201 6:13586145-13586167 GAAATCTACCCATCTGACAAAGG - Intronic
1006794193 6:36721704-36721726 GCCTCAGACCCAGATGACAAGGG + Exonic
1007031222 6:38628981-38629003 GACACAGACCCAGCTTGAAAAGG + Intronic
1007785574 6:44277455-44277477 GACATAGACCTGGGTGGCAACGG + Exonic
1008409629 6:51159331-51159353 GCCATCTACCCATCTGACAAAGG + Intergenic
1011756804 6:90508373-90508395 AACATAGATCAAGCTGAAAAAGG - Intergenic
1013769696 6:113613965-113613987 GGCATAGGCCCAGCTAACCATGG - Intergenic
1014368954 6:120581084-120581106 GCCATCTACCCATCTGACAAAGG - Intergenic
1014896402 6:126905246-126905268 GAGATAGAACGAGCTGATAAAGG - Intergenic
1016523427 6:144972605-144972627 GAAATCTACCCACCTGACAAAGG - Intergenic
1019382671 7:732737-732759 CACAAATACCCATCTGACAAGGG - Intronic
1021589235 7:22242479-22242501 GACCCTGACCCAGCTGAGAAGGG + Intronic
1026190229 7:68118977-68118999 GACATAGACCAACCTAACCATGG + Intergenic
1027930111 7:84521596-84521618 GCCATCTACCCATCTGACAAAGG + Intergenic
1028754366 7:94418674-94418696 GTCATAGACCCAGGAGAGAAAGG - Intronic
1030518644 7:110568647-110568669 GACATACACCCAGCAGATAATGG - Intergenic
1031312050 7:120211030-120211052 GCCATCTACCCATCTGACAAAGG + Intergenic
1031514899 7:122689315-122689337 GACATAGCCACAGCTGCCCAAGG - Intronic
1032602252 7:133310224-133310246 AACATATCCCCTGCTGACAAAGG - Intronic
1035493202 7:159298001-159298023 GAAATATATCCATCTGACAAAGG - Intergenic
1037051468 8:14379490-14379512 GACATAGCCCCTGCTCCCAAGGG + Intronic
1042833946 8:73060986-73061008 GCCATCTACCCATCTGACAAAGG + Intergenic
1043312021 8:78872473-78872495 GCAATTGACCCATCTGACAAAGG - Intergenic
1044173556 8:89087873-89087895 GAAAGAGACCAAGCTGACTAAGG + Intergenic
1044355781 8:91221271-91221293 GCAATCGACCCATCTGACAAAGG - Intronic
1044382240 8:91547951-91547973 AACATAGACCCATCTCTCAATGG - Intergenic
1044547036 8:93471524-93471546 TACAAATACCCATCTGACAAAGG + Intergenic
1044924054 8:97194942-97194964 GAAATAGACCAAGCTGACAGAGG + Intergenic
1048629916 8:136231302-136231324 GCCATCTACCCATCTGACAAAGG - Intergenic
1050004057 9:1109381-1109403 GCCATCTACCCATCTGACAAAGG - Intergenic
1051003165 9:12310433-12310455 GCAATCTACCCAGCTGACAAAGG - Intergenic
1051438323 9:17056037-17056059 GCCATCTACCCATCTGACAAAGG - Intergenic
1051846664 9:21458838-21458860 GCAATATACCCATCTGACAAAGG + Intergenic
1051960867 9:22761316-22761338 GCAATATACCCATCTGACAAAGG + Intergenic
1053069763 9:35094242-35094264 GACCTAGACACAGTGGACAATGG - Exonic
1053554779 9:39124600-39124622 GAAATCTACCCATCTGACAAAGG + Intronic
1056734146 9:89191065-89191087 GACAGAGCCCCATCTGACCAGGG - Intergenic
1056990009 9:91402005-91402027 AACATAGAACCAGTTGCCAAAGG - Intergenic
1059946070 9:119409602-119409624 GACATAGAGCCTGGTGACAGAGG - Intergenic
1186989924 X:15056342-15056364 GCCATCTACCCATCTGACAAAGG + Intergenic
1189125097 X:38437560-38437582 TACATAGATCCAGAGGACAAAGG + Intronic
1189726157 X:43969784-43969806 AGCAAAGAGCCAGCTGACAAAGG + Intronic
1190519047 X:51258187-51258209 GACATAGACCCAGCCATCATGGG + Intergenic
1191091287 X:56625169-56625191 GAAATCTACCCATCTGACAAAGG + Intergenic
1191596573 X:62950799-62950821 GAAATCTACCCATCTGACAAAGG + Intergenic
1193281030 X:79651117-79651139 GCCATCTACCCATCTGACAAAGG - Intergenic
1193339081 X:80324665-80324687 GCCATCTACCCATCTGACAAAGG + Intergenic
1193610338 X:83623864-83623886 GCCATCTACCCATCTGACAAAGG - Intergenic
1194597184 X:95872856-95872878 GCAATTGACCCATCTGACAAAGG + Intergenic
1194855768 X:98926720-98926742 GCAATATACCCATCTGACAAAGG + Intergenic
1195141008 X:101959747-101959769 GGCATAGACCAAGCTAACATTGG - Intergenic
1196115396 X:111993804-111993826 GCCATCTACCCATCTGACAAAGG - Intronic
1197347742 X:125345225-125345247 GGCATAGACCAAGCTAACGATGG - Intergenic
1197544418 X:127807952-127807974 GACACAGCACCAGCAGACAAGGG + Intergenic
1199358667 X:146891336-146891358 GCCATCTACCCATCTGACAAGGG + Intergenic
1199475462 X:148240177-148240199 GAAATCTACCCATCTGACAAAGG + Intergenic
1199485891 X:148347812-148347834 GAAATCTACCCATCTGACAAAGG - Intergenic
1199553263 X:149079604-149079626 GACATAGTAACAGCTGACCAAGG + Intergenic
1199789723 X:151141484-151141506 GCAATATACCCATCTGACAAAGG - Intergenic
1199897077 X:152136379-152136401 CACATGGACCCAGCTGAATATGG - Intronic
1199947892 X:152682236-152682258 CACATGGACCCAGCTGAATATGG + Intergenic
1199961787 X:152786218-152786240 CACATGGACCCAGCTGAATATGG - Intergenic
1200320907 X:155188616-155188638 GACAAAGAAATAGCTGACAAAGG - Intergenic
1200737821 Y:6819101-6819123 GCAATATACCCATCTGACAAAGG + Intergenic
1201506191 Y:14703063-14703085 GCAATCGACCCATCTGACAAAGG - Intronic