ID: 1000209556

View in Genome Browser
Species Human (GRCh38)
Location 5:159097276-159097298
Sequence ACATAGACCCAGCTGACAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 114}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000209546_1000209556 20 Left 1000209546 5:159097233-159097255 CCCCCAAAACATCCAGTGGGCGC 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1000209556 5:159097276-159097298 ACATAGACCCAGCTGACAACGGG 0: 1
1: 0
2: 0
3: 7
4: 114
1000209543_1000209556 26 Left 1000209543 5:159097227-159097249 CCTCTTCCCCCAAAACATCCAGT 0: 1
1: 0
2: 1
3: 33
4: 348
Right 1000209556 5:159097276-159097298 ACATAGACCCAGCTGACAACGGG 0: 1
1: 0
2: 0
3: 7
4: 114
1000209549_1000209556 17 Left 1000209549 5:159097236-159097258 CCAAAACATCCAGTGGGCGCTCT 0: 1
1: 0
2: 1
3: 6
4: 60
Right 1000209556 5:159097276-159097298 ACATAGACCCAGCTGACAACGGG 0: 1
1: 0
2: 0
3: 7
4: 114
1000209547_1000209556 19 Left 1000209547 5:159097234-159097256 CCCCAAAACATCCAGTGGGCGCT 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1000209556 5:159097276-159097298 ACATAGACCCAGCTGACAACGGG 0: 1
1: 0
2: 0
3: 7
4: 114
1000209550_1000209556 8 Left 1000209550 5:159097245-159097267 CCAGTGGGCGCTCTTCACGCCCC 0: 1
1: 0
2: 0
3: 1
4: 78
Right 1000209556 5:159097276-159097298 ACATAGACCCAGCTGACAACGGG 0: 1
1: 0
2: 0
3: 7
4: 114
1000209542_1000209556 29 Left 1000209542 5:159097224-159097246 CCTCCTCTTCCCCCAAAACATCC 0: 1
1: 2
2: 7
3: 96
4: 930
Right 1000209556 5:159097276-159097298 ACATAGACCCAGCTGACAACGGG 0: 1
1: 0
2: 0
3: 7
4: 114
1000209548_1000209556 18 Left 1000209548 5:159097235-159097257 CCCAAAACATCCAGTGGGCGCTC 0: 1
1: 0
2: 1
3: 6
4: 72
Right 1000209556 5:159097276-159097298 ACATAGACCCAGCTGACAACGGG 0: 1
1: 0
2: 0
3: 7
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000209556 Original CRISPR ACATAGACCCAGCTGACAAC GGG Intronic
900937580 1:5776213-5776235 ACACAGACCCAGATGAAGACAGG - Intergenic
902090159 1:13896730-13896752 GCATAGTCCCTGGTGACAACTGG + Intergenic
903583385 1:24389304-24389326 ACACAGACCAAGCTGAAGACAGG - Intronic
904284474 1:29445076-29445098 ACATAGTGACAGCTGACAGCAGG + Intergenic
906474513 1:46159489-46159511 AGAGAGCCCCAGCTAACAACTGG - Intronic
910085203 1:83393651-83393673 ACATAGACCCAACAGACGAAAGG + Intergenic
915852495 1:159340632-159340654 ACATAGAACCAGCTCACAATAGG - Intergenic
917776597 1:178343177-178343199 ACACAGACCCAGCCAAAAACTGG - Intronic
920907135 1:210181819-210181841 ACACACACCCAACAGACAACAGG + Intergenic
922774505 1:228208515-228208537 AAATAGCCCCAGCTGTCAGCGGG - Intronic
924863037 1:247946516-247946538 ACATAGTCTCAGCAGACCACAGG + Intronic
1066120968 10:32286816-32286838 ACTTAGACCAAACTGGCAACTGG - Exonic
1066232991 10:33455822-33455844 ACATCAACCCAGCTGAAACCTGG - Intergenic
1068151807 10:53141634-53141656 TCACATACACAGCTGACAACAGG - Intergenic
1070777370 10:79117750-79117772 ACAAAGACCCAGCTGAAGATGGG + Intronic
1070971315 10:80569763-80569785 ACATAGGCCGAGCTAACAATGGG - Intronic
1072502469 10:96031776-96031798 ACATAAACCCACATTACAACTGG - Intronic
1076803820 10:132845299-132845321 ACATGGCCCCGGCTGAGAACTGG - Intronic
1078751090 11:14164323-14164345 CCATGTATCCAGCTGACAACTGG - Intronic
1078850864 11:15162108-15162130 AGATGGACCCAGCTGACATCTGG + Intronic
1079246509 11:18756202-18756224 ACATTACCCCAGCTGACATCTGG + Intronic
1081667114 11:44923155-44923177 CCATACACCCAGCTGCCCACTGG - Intronic
1087737095 11:101846552-101846574 ACAGAGACCAAGGTGAGAACAGG + Intronic
1089160933 11:116436741-116436763 AGATCGACCCTGCTGACACCTGG - Intergenic
1089577202 11:119453614-119453636 ACAAGGACCCAGCTGAGAACTGG - Intergenic
1089931312 11:122316095-122316117 TCACAGAACCAGGTGACAACAGG + Intergenic
1090008679 11:123026071-123026093 ACATCGTCCCAGCTTAAAACAGG + Intergenic
1092075909 12:5673336-5673358 ACACAGACCCAGGAGACAAGCGG - Intronic
1098909458 12:76194236-76194258 ACATAGACCAAGCTAACTATGGG + Intergenic
1100448693 12:94684741-94684763 ACACAGACCCGGCTGATAAGAGG + Intergenic
1104090132 12:125509373-125509395 ACATGGCCCCATCTGACCACAGG - Intronic
1105852813 13:24350800-24350822 ACATATATCCTGCAGACAACGGG + Intergenic
1118399868 14:65369522-65369544 ACAAAGACCCTGCTGATAAAAGG + Intergenic
1119391278 14:74292788-74292810 CCATAGACCCCGCTGAAAATGGG + Exonic
1119832066 14:77712181-77712203 CCACAGCCCCAGCTGACACCTGG - Intronic
1122120948 14:99553053-99553075 ACAGAGGCCCAGCTGACCCCAGG - Intronic
1129678719 15:77646111-77646133 ACAGACACCCAGCTGCCAAGGGG + Intronic
1135215407 16:20562517-20562539 ACATAGACCAAGCTAACTATAGG + Intronic
1138723760 16:59113110-59113132 GCATAGACCCAGAGGACAAAAGG - Intergenic
1141142469 16:81505640-81505662 AGAGAGACCCAGCTTACAAGAGG - Intronic
1144283615 17:13751167-13751189 ACATCCTCCCAGCTGACAGCCGG + Intergenic
1144678997 17:17180381-17180403 ACACAGGCACAGCTGACAGCAGG - Intronic
1148691024 17:49527067-49527089 ACAGAGACCCATCTGAGACCTGG + Intergenic
1149497034 17:57125537-57125559 AAATAGGCCCAACTGACATCTGG + Intergenic
1151099207 17:71536460-71536482 CCATAGCTCCAGTTGACAACTGG + Intergenic
1153019937 18:619036-619058 ACATGGACCCAGCTGCCACACGG - Intronic
1156191975 18:34730622-34730644 AGGAAGTCCCAGCTGACAACTGG - Intronic
1156814566 18:41294308-41294330 ACATATTCCCAGATGACAACAGG + Intergenic
1160141050 18:76323448-76323470 ACCTACACCCAGGTGAGAACAGG + Intergenic
1160839717 19:1140658-1140680 ACACAGACCCAGCCGTCAGCAGG + Intronic
1166697956 19:44864872-44864894 ACCTAGACCCACTTGACAATGGG + Intronic
1168384228 19:55949617-55949639 ACATAGACCCTGCAGAGAAGGGG + Intronic
926207127 2:10841705-10841727 ACATTGCACCAGCTGACAAAGGG + Intergenic
927874345 2:26644816-26644838 GCACAGACCCAGATGACCACGGG + Intergenic
930763589 2:55061813-55061835 CCATAGACCTAGGTGACGACAGG + Intronic
931412475 2:62046059-62046081 ACATAGGCCAAGCTGACATTGGG - Intronic
932082103 2:68724636-68724658 ACTCAGACCCAGCTGCCTACTGG + Intronic
933297301 2:80504989-80505011 ACATACACCCAGCAGAGCACTGG + Intronic
944644124 2:201761445-201761467 AATGAGACCCAACTGACAACCGG + Exonic
945820061 2:214653034-214653056 ACACAGAGCCAGCTGAGAAGAGG + Intergenic
946210232 2:218141941-218141963 ACATATACCAAGCTGTCAATAGG + Intergenic
948342982 2:237270122-237270144 GCACAGACCCCGCTGACCACTGG - Intergenic
949008176 2:241662514-241662536 ACAAACACCCTGCTGTCAACAGG - Intronic
1169297812 20:4415015-4415037 ACATAGACCAAGCTAACTATAGG + Intergenic
1169636743 20:7700837-7700859 TCATAGACCCATGTGACATCTGG - Intergenic
1169720210 20:8667931-8667953 TCCTAGACCCTGCTGACAAGGGG - Intronic
1170621658 20:18001539-18001561 CCATGGCCCCAGCTGACACCAGG - Intronic
1173044084 20:39492778-39492800 ACATACATTCAGCTGACAGCAGG - Intergenic
1173537925 20:43830000-43830022 AAGTAGTCCCAGCTGCCAACAGG - Intergenic
1175574936 20:60053844-60053866 ACAAAGACCTAGCTCACAAGGGG + Intergenic
1176114147 20:63423806-63423828 ACATAGCCCGAGCTCACAGCTGG - Intronic
1178505662 21:33161006-33161028 ACATAGACCCATCTAACATTAGG + Intergenic
1179918378 21:44493211-44493233 ACATAGACCCAAATGGTAACAGG - Intergenic
1184989158 22:48155603-48155625 ACAGAGAACCAGCCGAAAACAGG + Intergenic
950949573 3:16984144-16984166 ACATAGCCCCAGTTGACAGGTGG + Intronic
952497836 3:33931586-33931608 ATATACACCCATGTGACAACTGG + Intergenic
956772899 3:72541606-72541628 CCACAGCCCCAGCTGACACCTGG - Intergenic
958692859 3:97490838-97490860 CCACAGTCCCAGCTGACACCAGG - Intronic
965436855 3:168663071-168663093 ACATAGTGCCTGCTGACAAAGGG + Intergenic
965824095 3:172713208-172713230 ATATAAACCAAGCTGACTACTGG + Intergenic
966801509 3:183768420-183768442 CCATTGCCCCAGCTGAAAACTGG + Intronic
970237481 4:13973277-13973299 ACATAGGCCAAGCTAACTACAGG + Intergenic
975611120 4:76204611-76204633 ACATAGAACCAGGTGAAAATTGG + Intronic
976188350 4:82465594-82465616 ACATATACACACCTTACAACAGG - Intergenic
980329193 4:131388728-131388750 ACAAAGCCCCAGCTGACACCTGG - Intergenic
980426076 4:132629602-132629624 ACATCTACCCAACTGACAAAGGG + Intergenic
981718976 4:147779743-147779765 TCATAGACCCTTCTGAAAACAGG - Intronic
985027140 4:185749121-185749143 ACATTGCCCCAGCTAACCACTGG + Intronic
986592078 5:9381388-9381410 ACATAGATCCAGCTCTCAATGGG - Intronic
988217962 5:28301437-28301459 ACATAGACCAAACTAACAATGGG + Intergenic
992344716 5:75865179-75865201 TCATAGACCCAGCTTATAACAGG - Intergenic
992788590 5:80193519-80193541 AAAGAGATCCAGCTGACACCTGG + Intronic
998284839 5:140849622-140849644 ACCTAGACGCAGATGCCAACGGG + Exonic
998853536 5:146373604-146373626 ACATAGACCCAGCCCTCAAGAGG + Intergenic
1000209556 5:159097276-159097298 ACATAGACCCAGCTGACAACGGG + Intronic
1002297319 5:178238884-178238906 ACATGGACTCAACTGACACCTGG - Intronic
1004514870 6:16314011-16314033 TCATGGACCCAGCTGATATCTGG - Intronic
1005369319 6:25114250-25114272 ACGCAGACTCAACTGACAACTGG + Intergenic
1007785575 6:44277456-44277478 ACATAGACCTGGGTGGCAACGGG + Exonic
1012296326 6:97529462-97529484 CCATAATCCCAGCTTACAACAGG - Intergenic
1017104414 6:150874426-150874448 AGAGAGACACAGCTGACAAATGG - Intronic
1017746686 6:157453113-157453135 AAGTAAACCCAGCTCACAACAGG - Intronic
1017759609 6:157557664-157557686 CAATGGACCCAGCTGACAAGAGG - Intronic
1020410816 7:7889571-7889593 ACCTACACCCAGAAGACAACTGG - Intronic
1023068611 7:36404320-36404342 ACATATACCCAGCGGATAAGTGG - Intronic
1023517503 7:41016677-41016699 AGAGAGACCCAGTTGACATCTGG - Intergenic
1023980084 7:45064414-45064436 ATACAGACTCAGCTGTCAACCGG - Intronic
1030518643 7:110568646-110568668 ACATACACCCAGCAGATAATGGG - Intergenic
1042005169 8:64171725-64171747 CCAGAGACCCAGCTGGCAGCAGG - Intergenic
1044382239 8:91547950-91547972 ACATAGACCCATCTCTCAATGGG - Intergenic
1044547037 8:93471525-93471547 ACAAATACCCATCTGACAAAGGG + Intergenic
1044924055 8:97194943-97194965 AAATAGACCAAGCTGACAGAGGG + Intergenic
1051717919 9:20004308-20004330 TCATAGGCCCAGCTGAACACCGG - Intergenic
1062648610 9:137564062-137564084 ACAGAGTCCCAGCTGACCACAGG + Intronic
1203492581 Un_GL000224v1:120815-120837 ACAAACACCCAGAAGACAACAGG - Intergenic
1203505204 Un_KI270741v1:62687-62709 ACAAACACCCAGAAGACAACAGG - Intergenic
1189125098 X:38437561-38437583 ACATAGATCCAGAGGACAAAGGG + Intronic
1189371018 X:40429335-40429357 ACACAACTCCAGCTGACAACTGG + Intergenic
1193515077 X:82452486-82452508 ACATAAACCCACATGCCAACAGG - Intergenic
1197233559 X:124032599-124032621 ACATAGACACTGCGGACTACTGG - Intronic
1197454049 X:126655218-126655240 TCACAGACCCAGCTGACAGTTGG + Intergenic
1197854088 X:130896397-130896419 AAATTCACCCAGCTGAAAACTGG - Intronic