ID: 1000210001

View in Genome Browser
Species Human (GRCh38)
Location 5:159100099-159100121
Sequence TCCTTTGCGTGTAGATGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000209999_1000210001 -8 Left 1000209999 5:159100084-159100106 CCAAAGATGTTTCTTTCCTTTGC No data
Right 1000210001 5:159100099-159100121 TCCTTTGCGTGTAGATGAGGAGG No data
1000209995_1000210001 8 Left 1000209995 5:159100068-159100090 CCTCCTTCTCTCCCAACCAAAGA No data
Right 1000210001 5:159100099-159100121 TCCTTTGCGTGTAGATGAGGAGG No data
1000209998_1000210001 -4 Left 1000209998 5:159100080-159100102 CCAACCAAAGATGTTTCTTTCCT No data
Right 1000210001 5:159100099-159100121 TCCTTTGCGTGTAGATGAGGAGG No data
1000209997_1000210001 -3 Left 1000209997 5:159100079-159100101 CCCAACCAAAGATGTTTCTTTCC No data
Right 1000210001 5:159100099-159100121 TCCTTTGCGTGTAGATGAGGAGG No data
1000209994_1000210001 29 Left 1000209994 5:159100047-159100069 CCTCTCTCTCTCTTTTTTTTTCC No data
Right 1000210001 5:159100099-159100121 TCCTTTGCGTGTAGATGAGGAGG No data
1000209996_1000210001 5 Left 1000209996 5:159100071-159100093 CCTTCTCTCCCAACCAAAGATGT No data
Right 1000210001 5:159100099-159100121 TCCTTTGCGTGTAGATGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000210001 Original CRISPR TCCTTTGCGTGTAGATGAGG AGG Intergenic
No off target data available for this crispr