ID: 1000212801

View in Genome Browser
Species Human (GRCh38)
Location 5:159123435-159123457
Sequence CTTTTTCCAAAAATAGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000212801_1000212807 -8 Left 1000212801 5:159123435-159123457 CCCCCCTCTATTTTTGGAAAAAG No data
Right 1000212807 5:159123450-159123472 GGAAAAAGTATTTGAAGGATTGG No data
1000212801_1000212808 27 Left 1000212801 5:159123435-159123457 CCCCCCTCTATTTTTGGAAAAAG No data
Right 1000212808 5:159123485-159123507 AAATATTTGATTGAATTTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000212801 Original CRISPR CTTTTTCCAAAAATAGAGGG GGG (reversed) Intergenic
No off target data available for this crispr