ID: 1000213031

View in Genome Browser
Species Human (GRCh38)
Location 5:159127003-159127025
Sequence ATATTATTCCACAGGTCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000213027_1000213031 4 Left 1000213027 5:159126976-159126998 CCCATTACACCTAGGTTGGTACA No data
Right 1000213031 5:159127003-159127025 ATATTATTCCACAGGTCTATAGG No data
1000213023_1000213031 27 Left 1000213023 5:159126953-159126975 CCTTTCCATCTCTTTCTGAGACT No data
Right 1000213031 5:159127003-159127025 ATATTATTCCACAGGTCTATAGG No data
1000213024_1000213031 22 Left 1000213024 5:159126958-159126980 CCATCTCTTTCTGAGACTCCCAT No data
Right 1000213031 5:159127003-159127025 ATATTATTCCACAGGTCTATAGG No data
1000213029_1000213031 -5 Left 1000213029 5:159126985-159127007 CCTAGGTTGGTACATTTAATATT No data
Right 1000213031 5:159127003-159127025 ATATTATTCCACAGGTCTATAGG No data
1000213028_1000213031 3 Left 1000213028 5:159126977-159126999 CCATTACACCTAGGTTGGTACAT No data
Right 1000213031 5:159127003-159127025 ATATTATTCCACAGGTCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000213031 Original CRISPR ATATTATTCCACAGGTCTAT AGG Intergenic
No off target data available for this crispr