ID: 1000216156

View in Genome Browser
Species Human (GRCh38)
Location 5:159158723-159158745
Sequence TGGGGTCAAAAGCCCCTTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 3, 1: 0, 2: 0, 3: 17, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000216156 Original CRISPR TGGGGTCAAAAGCCCCTTCC TGG Exonic
903344609 1:22676517-22676539 TATTGTCAAAAGCCCCTTCTGGG + Intergenic
903385096 1:22920962-22920984 TGGGGTCAGAGGCCACTTACTGG - Intergenic
904340983 1:29834402-29834424 TGGGTTCAAATGACACTTCCGGG + Intergenic
904450347 1:30606993-30607015 TGGACTGAGAAGCCCCTTCCAGG + Intergenic
905447861 1:38038938-38038960 TGGGGACAATATCCCATTCCAGG + Intergenic
905880328 1:41459220-41459242 TAGGGTCACATGCCCATTCCTGG + Intergenic
906971036 1:50513771-50513793 TAGGGATAAAAGTCCCTTCCTGG - Intronic
908802684 1:67896823-67896845 TGGCATCCAAAGCCGCTTCCAGG + Intergenic
909350959 1:74652879-74652901 TGGGGGAAAAACCCACTTCCTGG + Intronic
911184293 1:94887835-94887857 TGGTCTAAAAAGCCCTTTCCTGG + Intronic
912380852 1:109247494-109247516 TGAGCTCAGAAGCCCCTTCCAGG - Intergenic
921617213 1:217283381-217283403 AGGGAGCAAAACCCCCTTCCAGG + Intergenic
922227053 1:223654614-223654636 TGGAGTCCAGAGCCCCTGCCAGG + Intronic
923147376 1:231207672-231207694 TGGTGTCAAAAGGCCCAGCCAGG + Intronic
924531895 1:244900544-244900566 CGGGGTTAAAAACCACTTCCTGG + Intergenic
1063157127 10:3390501-3390523 TGGGGCAAAAACCCCCTTCCAGG + Intergenic
1064104209 10:12487682-12487704 TGAGGACAAAAGCCCCTTGTAGG - Intronic
1067696195 10:48537318-48537340 TGTGGACCAGAGCCCCTTCCTGG + Intronic
1070144509 10:73764032-73764054 AGGGGTCTAAAGCGTCTTCCTGG + Intronic
1070774796 10:79103368-79103390 TGGGGGCAACAGCCCCTCCTTGG - Intronic
1071567640 10:86680018-86680040 TGGGGCCAGAAGCTCCTGCCTGG - Intronic
1072417839 10:95263808-95263830 TGATGTGAAAAGCCCCTCCCAGG + Intronic
1074853019 10:117454017-117454039 TGTGGTCAAAAGAGACTTCCAGG - Intergenic
1075095094 10:119466071-119466093 TGGGGACAAAATCTCCTGCCAGG - Intergenic
1075943180 10:126408865-126408887 TGGGGTCAGGAACGCCTTCCTGG + Intergenic
1076658117 10:132037580-132037602 AGGGGTCAAAAGACCCCTGCTGG + Intergenic
1076681032 10:132171302-132171324 AGGGCACAAAAGCCCCTTGCTGG - Intronic
1078858197 11:15223722-15223744 TGGAGTCCCCAGCCCCTTCCAGG - Intronic
1079406744 11:20154397-20154419 AGGGCACAAAAGCCCCTGCCAGG + Intergenic
1079729249 11:23920280-23920302 TGGGTCCAAAAGTGCCTTCCAGG + Intergenic
1081253459 11:40863525-40863547 TTGGGTCAAATGCCCATACCAGG - Intronic
1083074605 11:60023237-60023259 TGTGCTCAAAAGCCCCTTGAGGG - Intergenic
1085157468 11:74309461-74309483 GGGGGTCAAAATCCCCCTGCTGG - Intronic
1087709394 11:101531843-101531865 GAGGTTCAAAAGCCCATTCCTGG + Intronic
1090303965 11:125674014-125674036 TGGGATCACAAGCGCCTGCCTGG - Intronic
1092923798 12:13256324-13256346 GGGGGTCATGAGCCACTTCCTGG - Intergenic
1096217236 12:49804627-49804649 TGCGGCCAAAAGCCTCTGCCTGG + Intronic
1099324517 12:81197336-81197358 TGCGGTCAAATGCACCTTCAGGG + Intronic
1104674179 12:130701559-130701581 TGGGGTGAAAAGTACCTTGCTGG + Intronic
1110039347 13:70732764-70732786 TGTGGTCAGTAGCCCCTGCCTGG - Intergenic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1114670386 14:24407946-24407968 TGGGGCCCAAGGCCTCTTCCTGG + Exonic
1115939729 14:38595385-38595407 TGGTTTCCAAAGCCTCTTCCTGG - Intergenic
1119543967 14:75458748-75458770 GGGAGTCAAAGGACCCTTCCTGG + Intronic
1119668417 14:76500420-76500442 TTGGGGCAAAGGCCCCTTCTTGG + Intronic
1121550374 14:94795180-94795202 TGGGCTCAAAAGATCCTGCCTGG - Intergenic
1122198261 14:100105950-100105972 TGGGGGCAAGAGCCTCCTCCCGG - Intronic
1123480466 15:20626872-20626894 TGGGGTCAAAAGCCCCTTCCTGG + Intergenic
1123637542 15:22373495-22373517 TGGGGTCAAAAGCCCCTTCCTGG - Intergenic
1125166360 15:36710504-36710526 TGGGGACAAAAGTAACTTCCCGG - Intronic
1125515276 15:40315627-40315649 GGGGGTCAGTTGCCCCTTCCAGG + Intergenic
1130142405 15:81239416-81239438 TGGGGTGAAAAGACCTTTCCTGG + Intronic
1132178518 15:99733756-99733778 TGGGGTCAAAGGCCTCTTTACGG - Intergenic
1132346401 15:101111586-101111608 TGGTCTCAAAAGCTCCCTCCTGG + Intergenic
1132554380 16:566153-566175 TGGGCTCCAGAGCCCATTCCAGG - Intergenic
1132589401 16:720134-720156 TGGGGTCTAGAGCCCCTGCAGGG - Intronic
1133744420 16:8675671-8675693 TGGGGCCTAGAGGCCCTTCCAGG + Intronic
1136031064 16:27503485-27503507 TGGAGTCAGAGGCCCCATCCTGG - Intronic
1137062946 16:35808939-35808961 TAGGGTCAAAAGACACTTTCTGG - Intergenic
1137298610 16:47123409-47123431 TGGGCTCAAAAGATCCTCCCAGG - Intronic
1138567867 16:57846522-57846544 TGGGCTGAACAGCGCCTTCCAGG - Intronic
1138607464 16:58098205-58098227 TGGGGTTACAAGCCCCTCTCTGG + Intergenic
1140033433 16:71356093-71356115 TGGGCTCAAAACCCTCTTGCTGG - Intergenic
1141630225 16:85283595-85283617 TGGGGTCCACAGCCCATCCCAGG - Intergenic
1142007274 16:87695486-87695508 TGGGGTCTACATCTCCTTCCAGG + Intronic
1142806880 17:2375981-2376003 TGGGCTCAGAACTCCCTTCCAGG - Intronic
1145902173 17:28496270-28496292 AGAGGTCAAGAGGCCCTTCCAGG + Intronic
1146260519 17:31417335-31417357 TGGGTTCAAAAGGCACTTCCCGG + Intronic
1150694288 17:67390802-67390824 TGGGGTCACCAACCACTTCCTGG + Intronic
1151149933 17:72076339-72076361 TGAGGTAACCAGCCCCTTCCAGG - Intergenic
1151325701 17:73378808-73378830 TGGGGCCAAAAGCCCCTTGGAGG + Intronic
1151453521 17:74213408-74213430 TGCAGTCAACAGCCCCTTTCTGG - Intergenic
1151967001 17:77436706-77436728 GGTGGGCAAAAGCCGCTTCCGGG + Intronic
1154148192 18:11884108-11884130 TGGGGCCACCAGGCCCTTCCTGG + Exonic
1157589352 18:48827014-48827036 TTGGCTCAAAGGCTCCTTCCTGG - Intronic
1158748671 18:60231919-60231941 TAGGGTCAAAAGCCCTTTTCTGG + Intergenic
1160247753 18:77173046-77173068 TGGACTCACAAGTCCCTTCCAGG + Intergenic
1162060331 19:8090882-8090904 TTGGATCAAAAACCCCTTCCTGG + Intronic
1162457999 19:10797376-10797398 GGGGGTGAAGAGCCCCGTCCTGG - Exonic
1162797442 19:13094251-13094273 TGGGTACAAAAGCCCCAGCCTGG + Intronic
1163439733 19:17316049-17316071 TGTGCTCAGAAGCCCCTGCCAGG - Intronic
1163908452 19:20168059-20168081 TGGGGTTAAAAACCCATTCCTGG + Intronic
1163938711 19:20473877-20473899 TAGGGTTAATAACCCCTTCCTGG + Intergenic
1165480486 19:36060652-36060674 GGGGGTGAAAAGCACATTCCTGG - Intronic
926400771 2:12493730-12493752 TGAGGTCACAAGGCCTTTCCTGG + Intergenic
927277427 2:21273731-21273753 TGGGGTGCAAAGACCCTGCCAGG + Intergenic
927792994 2:26025298-26025320 TGGTTTCAAAACCACCTTCCAGG - Intergenic
929536301 2:42786554-42786576 TGGGGACAACAGCCCCTGTCTGG - Intronic
931683986 2:64777449-64777471 TGGGGACAAAAGCCCAGACCTGG + Intergenic
931792078 2:65672602-65672624 TGGCATCAAAAGCCCAGTCCAGG + Intergenic
933780281 2:85796245-85796267 TGGTGACTAAAGCCTCTTCCAGG + Intergenic
936630793 2:114200685-114200707 TGGGGACTAAAGGCCCTACCTGG + Intergenic
937223044 2:120353120-120353142 TGGGGTCCCCAGGCCCTTCCTGG - Intergenic
937277456 2:120694571-120694593 CAGCGTCAAAAGCCCTTTCCAGG - Intergenic
937312728 2:120911946-120911968 TGGAGTCAAGAGCCCCAGCCTGG - Intronic
938825776 2:135004195-135004217 TGGTGTCCCAAGCACCTTCCAGG - Intronic
939500473 2:142976983-142977005 TGGTGTCCACAGCCCCTTACTGG - Intronic
940396369 2:153196517-153196539 TGGGGGCAAAGGGCCCTTCCTGG + Intergenic
944424750 2:199568713-199568735 TGTGGTTAAGAGCCACTTCCAGG + Intergenic
1168807341 20:679777-679799 GGGGGACAGAAGGCCCTTCCTGG - Intergenic
1169208360 20:3752445-3752467 CGGGGTCACATGCCCCTTGCCGG - Exonic
1170612254 20:17924311-17924333 TGTGGTCCAAAGCCCCGTGCCGG + Intergenic
1172803363 20:37593952-37593974 TGGCTTCAAGTGCCCCTTCCTGG + Intergenic
1172888060 20:38245133-38245155 TTGGGTCATATGCCCATTCCTGG - Intronic
1174261809 20:49301600-49301622 GGGGGTGAAAAACCCCTTACTGG - Intergenic
1175854644 20:62113915-62113937 TGGGGTCTATAGCCCCTTTCAGG - Intergenic
1176069402 20:63218256-63218278 TGGAGACAGAAGCTCCTTCCAGG + Intergenic
1178875826 21:36413184-36413206 TGCTGTCAAAAGCCCCTTGCCGG + Exonic
1180057775 21:45367746-45367768 TGGGCTCAAAAGCCACGCCCAGG - Intergenic
1181695607 22:24591428-24591450 TGGGGTCTAGAGGCCCCTCCTGG - Intronic
1182509111 22:30806451-30806473 TGAGATCACAAGCCCCATCCTGG - Intronic
1183429256 22:37755893-37755915 GTGAGTCAAAAGCCCCTGCCAGG + Intronic
1183664450 22:39239374-39239396 TGGGCTTACAAGGCCCTTCCGGG + Intronic
1183965013 22:41436403-41436425 TGGTGCCAACAGCCTCTTCCTGG - Exonic
1184654473 22:45934236-45934258 TGGGGGCAGAAGGACCTTCCAGG - Intronic
1184667037 22:45994723-45994745 GGGGCACAAAAGCTCCTTCCTGG + Intergenic
1185132361 22:49046467-49046489 TCAGGTCAAAGGCCCCTTCCAGG - Intergenic
952125370 3:30293724-30293746 TGGGTTGAAAACCCTCTTCCAGG + Intergenic
952335092 3:32396882-32396904 TAGGGCCACAAGCCCCATCCTGG - Intronic
953877937 3:46676958-46676980 GGGAGTCTACAGCCCCTTCCGGG - Exonic
954116076 3:48467503-48467525 TGGGGCCAGCAGCCCCTCCCTGG - Exonic
954693606 3:52409151-52409173 TGGGGTGACAAGGCCCCTCCTGG - Intronic
956575552 3:70748762-70748784 TGGGCTCCAAAGCCTCTTGCTGG - Intergenic
956750570 3:72341013-72341035 TGGGGACAGGAGCCTCTTCCAGG + Intergenic
959486799 3:106936157-106936179 TGGGGTCAAGAAACCATTCCAGG + Intergenic
967217759 3:187224821-187224843 TGGGGTGAAAAACCACTGCCAGG - Intronic
968454375 4:689491-689513 TGGGGTCCACAGCCCCCTTCAGG - Intergenic
968688678 4:1978447-1978469 TGGAGTCAACAGGCCCTGCCAGG + Intronic
973539421 4:51921523-51921545 TGGAGCCAAAAGCAGCTTCCAGG - Intergenic
973862575 4:55079756-55079778 TTGGGTCACAAGCCTCTTCCAGG + Exonic
975310416 4:72897895-72897917 TGGGCTTAAAGCCCCCTTCCTGG - Intergenic
978776509 4:112510989-112511011 TTGGGTCTAAACGCCCTTCCTGG + Intergenic
981657288 4:147125905-147125927 TTGGGTCAAGAGGGCCTTCCAGG + Intergenic
984830238 4:183966132-183966154 AGGGGTCAAAACTCCCTCCCTGG - Intronic
986224447 5:5800136-5800158 TGGGGTGTAGTGCCCCTTCCTGG + Intergenic
987162222 5:15156130-15156152 TGGAGTCAAAAATGCCTTCCTGG + Intergenic
990324461 5:54661140-54661162 TGGGTTGAATAGACCCTTCCAGG - Intergenic
992176730 5:74156706-74156728 TGGGGTCGATAGCACCATCCTGG - Intergenic
1000216156 5:159158723-159158745 TGGGGTCAAAAGCCCCTTCCTGG + Exonic
1005887180 6:30106071-30106093 TGGGGACAATGGCCCATTCCTGG + Intronic
1006256589 6:32837586-32837608 GGGGGTCAAAATCACCTCCCAGG + Exonic
1007523919 6:42474368-42474390 TGGGTTCACATGCCCCTTCTAGG + Intergenic
1011836679 6:91439885-91439907 TGTGGTCAAAAACCCCATCATGG - Intergenic
1017603645 6:156110471-156110493 TGGGGTCAAATGGCCCCTTCAGG + Intergenic
1017699993 6:157059718-157059740 TGGGCTCTAAAGCTCCTGCCTGG + Intronic
1021377431 7:19925143-19925165 TGGGGACTAAAGCCTGTTCCAGG + Intergenic
1021536477 7:21710640-21710662 TGGGGTCAATATCGCCATCCAGG - Exonic
1025027871 7:55533101-55533123 TGGCATCAAAATCACCTTCCTGG - Intronic
1025158455 7:56631120-56631142 TGGTTCCAATAGCCCCTTCCTGG + Intergenic
1025757272 7:64357033-64357055 TGGTGCCCACAGCCCCTTCCTGG - Intergenic
1026069312 7:67103934-67103956 TAAGGTCAAAAGCCCCTCCCAGG - Intronic
1026246819 7:68627897-68627919 GGGGATCAATAGCCCCTTGCTGG - Intergenic
1026707589 7:72708383-72708405 TAAGGTCAAAAGCCCCTCCCAGG + Intronic
1032587692 7:133162832-133162854 TGGGGCCAGAAGCCCTTTCAAGG - Intergenic
1034895975 7:154876560-154876582 TGGGGCCAGAATGCCCTTCCCGG + Intronic
1035320271 7:158024618-158024640 TGGGGTCAGGAGCCACATCCTGG - Intronic
1035698827 8:1622425-1622447 TGGGGTCAGAGGCCCTTTCAGGG + Intronic
1036201715 8:6775959-6775981 TGGGTTCCAAAGCCCTTACCAGG + Intergenic
1037543502 8:19895050-19895072 TGGGTTCCAAAGCCATTTCCTGG + Intergenic
1038169589 8:25117009-25117031 TGGTGACAGAAGCCCCTTCCTGG + Intergenic
1040387373 8:46922647-46922669 TGGGGTCAAAAACCACTTAACGG + Intergenic
1040637352 8:49290591-49290613 TGAGGTCATAAGCCCCTTGCTGG + Intergenic
1047300721 8:123611709-123611731 TGGGGTCAGAAAGCACTTCCTGG - Intergenic
1048282522 8:133115619-133115641 TGGGGCCAAAGGTCCCTACCTGG - Intronic
1049338694 8:142100428-142100450 TGTGCTCCAGAGCCCCTTCCAGG + Intergenic
1050105610 9:2163392-2163414 TGCGGTCAAAATTTCCTTCCTGG - Intronic
1050583439 9:7085165-7085187 AGGGCTCCAATGCCCCTTCCTGG - Intergenic
1054726982 9:68662626-68662648 TGGCCTCTAAAGTCCCTTCCTGG + Intergenic
1055455848 9:76470883-76470905 TGGTGTCCTAAGCCCATTCCTGG - Intronic
1057612443 9:96557340-96557362 TGAGGTCATAACACCCTTCCTGG - Intronic
1060489156 9:124069414-124069436 TGGCATAAAAAGCCCTTTCCTGG + Intergenic
1060775261 9:126368386-126368408 CAGGCTCCAAAGCCCCTTCCTGG - Intronic
1062517017 9:136941901-136941923 TGGGGTCACAAGCCCAGACCTGG - Intronic
1189949852 X:46217556-46217578 TGGGTTCAAATCCCACTTCCAGG - Intergenic
1195968368 X:110449520-110449542 TGTGTCCAAAAGCCCCTTCTGGG + Intronic
1202269690 Y:23060040-23060062 TGGTGGGAATAGCCCCTTCCTGG - Intergenic
1202422684 Y:24693786-24693808 TGGTGGGAATAGCCCCTTCCTGG - Intergenic
1202448105 Y:24976300-24976322 TGGTGGGAATAGCCCCTTCCTGG + Intergenic