ID: 1000218476

View in Genome Browser
Species Human (GRCh38)
Location 5:159187726-159187748
Sequence GGGTATCACTGGGGTCTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000218476 Original CRISPR GGGTATCACTGGGGTCTAGT GGG Intronic
900783109 1:4630789-4630811 GGGTAACCCTGGGGTCTCGCAGG - Intergenic
901511396 1:9719786-9719808 GGGTCTCCCAGGGGTCTGGTTGG + Intronic
904389106 1:30169285-30169307 GGGTATCACCTGGGTCTTCTTGG + Intergenic
904994211 1:34618301-34618323 GGGTTGCACTGGCATCTAGTGGG + Intergenic
905385328 1:37599380-37599402 GTTTATCACTGGGGTCTAATGGG + Intergenic
906089652 1:43167880-43167902 GGGTACTACTGGCATCTAGTAGG - Intronic
906820030 1:48919707-48919729 GGGTGTTACTGGCATCTAGTGGG - Intronic
906822025 1:48939916-48939938 GGGTGCCACTGGCATCTAGTGGG + Intronic
909175804 1:72357186-72357208 GGGTAAATCTGGGATCTAGTGGG - Intergenic
909749450 1:79140877-79140899 GGTTATCACTGCAGTCTATTAGG + Intergenic
911272256 1:95816756-95816778 GGGTGCTACTGGTGTCTAGTTGG + Intergenic
911295409 1:96108593-96108615 GGGTGTCACTGGAGGCTTGTGGG - Intergenic
912351656 1:109019547-109019569 GGATACTACTGGGATCTAGTGGG + Intronic
915926154 1:160021249-160021271 GGATGTTACTGGCGTCTAGTGGG - Intergenic
916262094 1:162852196-162852218 GGCTGCCACTGGAGTCTAGTAGG - Intronic
1063658052 10:8011341-8011363 GGGGATCACTGGGGCCCAGGAGG - Intronic
1068484655 10:57642349-57642371 GGGTACAACTAGGATCTAGTTGG - Intergenic
1068550597 10:58403781-58403803 GGGTACTACTGGCATCTAGTGGG + Intergenic
1068559573 10:58498459-58498481 GGGTACTACTGGCATCTAGTAGG - Intergenic
1072415206 10:95241504-95241526 GGATGCCACTGGCGTCTAGTGGG + Intronic
1072692890 10:97583394-97583416 GGGTACTACTGGCATCTAGTGGG - Intronic
1076555743 10:131320424-131320446 GGGTTTCACGGGGGTCTGGGAGG + Intergenic
1078014621 11:7602443-7602465 TGAGCTCACTGGGGTCTAGTAGG + Intronic
1080389701 11:31833722-31833744 GGGCATCTCTGGGGCCTAGTCGG + Intronic
1081222232 11:40476017-40476039 GGGTATTACTGGCACCTAGTGGG - Intronic
1081722472 11:45300422-45300444 AGTTATCACTGGCATCTAGTTGG + Intergenic
1085481357 11:76825320-76825342 GTGTATCACTGGGTGCTAGTTGG - Intergenic
1087111147 11:94469301-94469323 GGGTACTACTGGCATCTAGTGGG + Intronic
1088611466 11:111581344-111581366 GGGTGCTACTGGTGTCTAGTGGG + Intergenic
1091728558 12:2863147-2863169 GGGTGCTACTGGCGTCTAGTGGG + Intronic
1092127685 12:6086361-6086383 TGGTGTCACTGGGGCATAGTGGG + Intronic
1095210904 12:39493477-39493499 GGGTATCACTTGAGCCTAGGAGG - Intergenic
1101040052 12:100746626-100746648 AGGTATCACAGGCATCTAGTGGG + Intronic
1101938938 12:109084503-109084525 GGGTGCTACTGGTGTCTAGTGGG + Intronic
1102218224 12:111176977-111176999 GTGTACTACTGGCGTCTAGTGGG - Intronic
1103009028 12:117443584-117443606 GGTTATTACTGGCATCTAGTGGG - Intronic
1103298859 12:119911804-119911826 GGGTATTGCTGGCATCTAGTGGG - Intergenic
1104617848 12:130285286-130285308 GGGTTCCACTGGCATCTAGTAGG + Intergenic
1107359697 13:39604538-39604560 GAGTATTACTGGCATCTAGTTGG + Intergenic
1107634589 13:42379295-42379317 TTGTACCACTGGTGTCTAGTGGG + Intergenic
1108380346 13:49848577-49848599 GGGTCTCACTGTTGCCTAGTTGG - Intergenic
1111213434 13:85110820-85110842 GGGTATCACTTGAGTCCAGGAGG - Intergenic
1115705200 14:35991076-35991098 GAGAATCACTGTGGTCTGGTAGG + Intergenic
1117223479 14:53631313-53631335 GGGTATCATTGGGAACTTGTAGG + Intergenic
1118375916 14:65176866-65176888 GGGTATCACTGTTGTCTTGTAGG + Intergenic
1120865387 14:89291885-89291907 GGGTGTCACTGGTGTCTAGTGGG - Intronic
1121254310 14:92520084-92520106 GGGTATTACTGAGGTCAAATTGG - Intronic
1122957054 14:105075754-105075776 GGGTGCCACTGGCTTCTAGTGGG + Intergenic
1129973922 15:79805321-79805343 GGGTGGCACTGGGGTCTAGCTGG - Intergenic
1131496214 15:92913452-92913474 GGGTGTTACTGGCCTCTAGTGGG + Intronic
1131659299 15:94497199-94497221 GGGTACTACTGGTGTCTAGTTGG - Intergenic
1133379895 16:5321188-5321210 TGGTATTACTGGCATCTAGTGGG - Intergenic
1133744763 16:8677640-8677662 GAGTGTCACTGGCATCTAGTGGG - Intronic
1133746159 16:8688223-8688245 GGGTAACACTGGGTACTACTTGG + Intronic
1134066498 16:11231903-11231925 GGGTACTACTGGTATCTAGTGGG + Intergenic
1134416664 16:14049088-14049110 GGATACTACTGGCGTCTAGTGGG + Intergenic
1134749613 16:16615569-16615591 GAGTATCACTTGGGCCTAGGAGG - Intergenic
1134824201 16:17271653-17271675 GCACATGACTGGGGTCTAGTGGG - Intronic
1134995857 16:18738055-18738077 GAGTATCACTTGGGCCTAGGAGG + Intergenic
1136107339 16:28039372-28039394 GGGTGCCACTGGCATCTAGTTGG + Intronic
1136736497 16:32472031-32472053 AGGTACCACTGGGTTCTGGTTGG - Intergenic
1137359400 16:47799313-47799335 GGTTCTCTCAGGGGTCTAGTGGG + Intergenic
1139283979 16:65794314-65794336 GGGTACTACTGGCATCTAGTGGG + Intergenic
1140273926 16:73491781-73491803 GGGTGTCACTGACATCTAGTAGG + Intergenic
1141756123 16:85992158-85992180 GGGTACGACTGGCATCTAGTGGG - Intergenic
1141801874 16:86315311-86315333 GGACATCACTGGGCTTTAGTGGG + Intergenic
1141801903 16:86315449-86315471 GGGTATCACTGGGTTTTACTGGG + Intergenic
1203016573 16_KI270728v1_random:357547-357569 AGGTACCACTGGGTTCTGGTTGG + Intergenic
1203034908 16_KI270728v1_random:630705-630727 AGGTACCACTGGGTTCTGGTTGG + Intergenic
1143037237 17:4006375-4006397 GGGGATCACTGGTGGCTAGGAGG + Exonic
1143774883 17:9192529-9192551 GGGTGTCGCTGGCATCTAGTGGG + Intronic
1151399245 17:73844826-73844848 AGGTCTCACAGGGGTCTTGTTGG - Intergenic
1154960018 18:21298842-21298864 GGGGATCACTGGAGTCTGGGAGG + Intronic
1158395364 18:57075289-57075311 GGGTGCCACTGGCATCTAGTGGG - Intergenic
1161312186 19:3600916-3600938 GGGGATCACTTGGGTCCAGAAGG - Intronic
1162339699 19:10085267-10085289 GGGAACCACTGGCATCTAGTGGG + Intergenic
1163435640 19:17293553-17293575 GGGTACTACTGGCATCTAGTGGG - Intronic
1163493059 19:17628124-17628146 GGGCATCTCTGGGGACTGGTGGG + Intronic
926539949 2:14163595-14163617 AGATGTCTCTGGGGTCTAGTTGG - Intergenic
927836965 2:26406905-26406927 GGGGATCACTTGAGTCTAGCTGG - Intronic
928089250 2:28363987-28364009 GGGTACCACTGGGGTGGGGTGGG + Intergenic
928175810 2:29033668-29033690 GGGTATCGCTGAGACCTAGTTGG + Intronic
929642131 2:43592546-43592568 GGGTGCCACTGGCATCTAGTGGG - Intronic
931096635 2:58947879-58947901 GTGTAATACTGGGGTCTAGAAGG + Intergenic
931354359 2:61521864-61521886 GGGTATCAGTGGGGTGAGGTAGG - Intronic
934064435 2:88327563-88327585 GGGTACAACTGGCATCTAGTAGG - Intergenic
944651850 2:201838267-201838289 GGGTATCACTGGCATCTAGTGGG + Intronic
945067117 2:205956583-205956605 GGGTGCCACTGGCATCTAGTAGG + Intergenic
947522031 2:230853726-230853748 GTGTGTCACTGGGCTCTAGTGGG - Intergenic
948499470 2:238381359-238381381 GGGTGTCAGTGGGGTTCAGTGGG - Intronic
949042781 2:241857241-241857263 GGGCATGACTGGGGTCCTGTGGG - Intronic
1173914614 20:46697714-46697736 GGGTCTCACTGGGGTGAAATTGG + Intergenic
1174688788 20:52481977-52481999 GGGTGTTACTGGCATCTAGTGGG + Intergenic
1175663565 20:60838655-60838677 GGGCACCACTGGCATCTAGTGGG - Intergenic
1178390480 21:32193960-32193982 GGGTACCACTGGCCTCTCGTGGG - Intergenic
1178723909 21:35034619-35034641 GGTTGTCACTAGTGTCTAGTGGG + Intronic
1178761607 21:35408225-35408247 GTGTACTACTGGTGTCTAGTGGG - Intronic
1180692366 22:17727865-17727887 GGGTGCCACTGGCATCTAGTGGG - Exonic
1182656594 22:31895193-31895215 GGGTGCTACTGGTGTCTAGTGGG + Intronic
1182721477 22:32404766-32404788 GAGGATCACTTGGGTCTAGGAGG - Intronic
1182750763 22:32640501-32640523 GAGTACCACTGGGGTGGAGTAGG + Intronic
1184448297 22:44567159-44567181 GGGGATGACTGGGGTCTGGCAGG + Intergenic
950528383 3:13538185-13538207 GGGTATCTCTGGGCTCTCATTGG + Intergenic
951153122 3:19316276-19316298 GGGTATTACTGGCATTTAGTGGG - Intronic
952116150 3:30183994-30184016 GGGTTCCACTGGAGTTTAGTTGG + Intergenic
953209163 3:40859038-40859060 GTGTATCCCTGGGCTCTACTTGG - Intergenic
953682171 3:45047767-45047789 GGGTATTGCTGGCGTCTAGCGGG - Intergenic
954013451 3:47663741-47663763 GGGTACCACCGGGTTCTCGTGGG - Intronic
954493440 3:50930405-50930427 GGGTCTCCCTGGGCTCTTGTGGG - Intronic
961234619 3:125355391-125355413 GGGTTCCACTGGCATCTAGTGGG - Intronic
961238863 3:125392534-125392556 GGGCATTACTGGCATCTAGTGGG + Intergenic
962086416 3:132196457-132196479 GGGTAGCACTGGGCTCATGTTGG - Intronic
962648969 3:137468685-137468707 GGGTAGCAGTGGGGCATAGTGGG + Intergenic
962876761 3:139541220-139541242 GGGTGCCACTGGGATCTAATGGG - Intergenic
963335335 3:143968990-143969012 GGGTACTACTGTTGTCTAGTGGG - Intergenic
964123009 3:153206127-153206149 GAGGATCACTTGGGCCTAGTAGG + Intergenic
966510675 3:180759136-180759158 GGATATTACTGGCATCTAGTGGG - Intronic
968311970 3:197691435-197691457 GGTTACCACTGGCATCTAGTAGG + Intronic
968607029 4:1540373-1540395 GGGAGTCCCTGGGGTCTTGTGGG - Intergenic
970569155 4:17362677-17362699 GAGTATTACTGGCATCTAGTGGG - Intergenic
973052673 4:45613627-45613649 GGGTAACATTGGGGTGGAGTAGG - Intergenic
975452216 4:74541993-74542015 GTTTATCACTGGAGTCCAGTGGG - Intergenic
976215446 4:82711345-82711367 GGGTGTTACTGGCATCTAGTGGG + Intronic
976966872 4:91054054-91054076 TGGTATCACTGGGTTATAGGGGG + Intronic
981808246 4:148741594-148741616 GGGTATCACTTGAGCCTAGGAGG + Intergenic
982616639 4:157645239-157645261 GGATATCACTTGGGTAAAGTAGG - Intergenic
983924402 4:173383230-173383252 ACGTGTCTCTGGGGTCTAGTTGG + Intergenic
987213112 5:15704810-15704832 GGGCAGCACTTGGGTTTAGTTGG + Intronic
990680240 5:58234705-58234727 GGGTGTTACTGGCATCTAGTTGG + Intergenic
996185906 5:120474990-120475012 TGGTTTCACTGCTGTCTAGTGGG + Intronic
997421739 5:133774386-133774408 GGGTACTACTGGTATCTAGTGGG + Intergenic
998375375 5:141687140-141687162 GGGTAGCTCTGGAGTCTAGGGGG - Intergenic
998788427 5:145738055-145738077 TGATATCAGTGGAGTCTAGTGGG + Intronic
1000028111 5:157377494-157377516 GGGTATGCCTGGGGTCTATGGGG - Intronic
1000218476 5:159187726-159187748 GGGTATCACTGGGGTCTAGTGGG + Intronic
1001681234 5:173558467-173558489 GGGTGCTACTGGTGTCTAGTGGG - Intergenic
1002329020 5:178428962-178428984 GGGCAGCACTGGGGTGTGGTAGG - Intronic
1003488625 6:6601292-6601314 GGGGATGACTGTGGTTTAGTAGG - Intronic
1005258695 6:24033437-24033459 GGGTGTCACTGTGCTCTAGTGGG + Intergenic
1008032476 6:46712551-46712573 GGGTATTTCTGGTGTCTAGTGGG + Intronic
1008418414 6:51269720-51269742 GGGTATCACTTGTGCCTAGGTGG + Intergenic
1011528400 6:88292473-88292495 GAGTATCTCTGGGTTCTAGGTGG - Intergenic
1012310664 6:97720355-97720377 GGTTATCACTGAGGTCAACTTGG + Intergenic
1013513521 6:110864939-110864961 GTGTTTCCCTGGGGTCTAATAGG - Intronic
1021918332 7:25457469-25457491 GGATGTCACTGGCCTCTAGTGGG + Intergenic
1022077341 7:26985050-26985072 GAGGATCACTGGAGTCTAGGAGG + Intronic
1022218646 7:28290403-28290425 GGGTGTTACTGGCATCTAGTGGG + Intergenic
1022331698 7:29385449-29385471 GGGTATTCCTGGCCTCTAGTGGG - Intronic
1022509996 7:30928876-30928898 AGGTATCAGTGGGGACTAGTGGG - Intergenic
1022751538 7:33231915-33231937 GGGTACTACTGGCATCTAGTGGG - Intronic
1024668329 7:51567138-51567160 GGGTACTACTGGCATCTAGTGGG - Intergenic
1028576148 7:92353580-92353602 GTGTATCACTGCTGTATAGTAGG + Intronic
1028960877 7:96748935-96748957 GGGTAATGCTGGCGTCTAGTGGG - Intergenic
1029024769 7:97404588-97404610 GGGTACTACTGGCATCTAGTGGG - Intergenic
1029846312 7:103415502-103415524 GAGTATTACTGGCATCTAGTGGG + Intronic
1030488664 7:110204176-110204198 GGGTATCACTGCTGTTTATTCGG + Intergenic
1031159850 7:118153213-118153235 GGGTGCCACTGGCATCTAGTAGG - Intergenic
1036633660 8:10532638-10532660 GGGGCTGACTGGGGTCAAGTTGG + Intronic
1043156768 8:76792240-76792262 GTGTGTCACTGGTGTTTAGTTGG + Intronic
1043286138 8:78533768-78533790 GGGTGTCACTGGAGCCTAGGAGG + Intronic
1045144804 8:99329942-99329964 GGGTGCCACTGGTATCTAGTGGG - Intronic
1045447868 8:102286090-102286112 GGGTTTCACTGGCATCTAGTGGG + Intronic
1045492923 8:102684019-102684041 GTGTACCACTGGCATCTAGTGGG + Intergenic
1046753185 8:117946243-117946265 AAGTATGACTGGGGTCTAGAGGG + Intronic
1046880433 8:119300914-119300936 GGATGGCACTGGGGTCTACTGGG - Intergenic
1048755487 8:137733322-137733344 GGGGATCATGGGGCTCTAGTGGG + Intergenic
1050176330 9:2873048-2873070 GGGTAGCACTGGGGGGAAGTCGG - Intergenic
1053152583 9:35752366-35752388 GTGTATCACAGGGTCCTAGTAGG - Intronic
1057273057 9:93661301-93661323 CGGCATCACAGGGGTGTAGTGGG + Intronic
1057326989 9:94074615-94074637 TGGTGTCAATGGGGTCCAGTGGG - Intronic
1059094175 9:111394785-111394807 GGGTGCCACTGGTCTCTAGTGGG - Intronic
1185750860 X:2609043-2609065 GGGTTTCACTTTGCTCTAGTTGG + Intergenic
1187742813 X:22374689-22374711 GAGCATCACTGGTGTTTAGTGGG - Intergenic
1188025097 X:25200021-25200043 TGGTGCCACTGGCGTCTAGTGGG + Intergenic
1188168060 X:26886952-26886974 GGGTACCACTAGCATCTAGTGGG + Intergenic
1189054726 X:37686511-37686533 TGGTTTCTCTGGGGTCAAGTAGG + Intronic
1190620845 X:52285233-52285255 GGGTGTCTCTGGGCTCTAGGGGG - Intergenic
1191868591 X:65726126-65726148 GGTTGTCGCTTGGGTCTAGTGGG + Intronic
1193115523 X:77771852-77771874 GGGTGTTACTGGTATCTAGTGGG + Intronic
1194973607 X:100371203-100371225 TGGTATCCCTGGATTCTAGTAGG - Intronic
1197295927 X:124718939-124718961 GGGTACTACTGGCATCTAGTGGG + Intronic
1198033352 X:132777081-132777103 GGGTACAACTGGCATCTAGTAGG + Intronic