ID: 1000219161

View in Genome Browser
Species Human (GRCh38)
Location 5:159195456-159195478
Sequence GTTTGTAAAGGGATTGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000219161_1000219169 9 Left 1000219161 5:159195456-159195478 CCATCTACAATCCCTTTACAAAC 0: 1
1: 0
2: 3
3: 16
4: 218
Right 1000219169 5:159195488-159195510 TTGTTTGCTCTAAAGAAAGTTGG 0: 2
1: 0
2: 1
3: 20
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000219161 Original CRISPR GTTTGTAAAGGGATTGTAGA TGG (reversed) Intronic
900686096 1:3948594-3948616 TTCTGTAAAGGGAAGGTAGATGG + Intergenic
901729349 1:11267600-11267622 GTTTTTAAGGGGATTGTAGAGGG + Intergenic
902594690 1:17501096-17501118 GTTTTTACAGCTATTGTAGAAGG + Intergenic
904502083 1:30919057-30919079 ATTTCTAAGGGGATTGTTGAGGG + Intergenic
904580543 1:31540509-31540531 GTATGTAGAGGGAGGGTAGATGG + Intergenic
904801126 1:33093563-33093585 GTTTGAAAAGGAAGTTTAGAAGG + Intronic
905164940 1:36074951-36074973 CTTTATAAAGGCATTGTAGCTGG - Intergenic
906941196 1:50256927-50256949 TGTTGTATAGGAATTGTAGAGGG + Intergenic
907148883 1:52263396-52263418 GTTTGGAAAGGAATTATAGCAGG - Intronic
907265040 1:53253793-53253815 TCTTGTGAAGGGATGGTAGAAGG - Intronic
908742049 1:67339118-67339140 GTTTGTTAAGTCATTGAAGAGGG + Intronic
909014883 1:70370609-70370631 GGTTGTAGAGGGGTTGTGGAGGG - Intronic
909361916 1:74770004-74770026 GTTTATAAATGCATTGTAGCTGG + Intergenic
910315924 1:85883706-85883728 GTTAGTACAGGGATTGGAGATGG - Intronic
911307549 1:96249446-96249468 GTATGTAAATGGATTGCTGATGG - Intergenic
913283009 1:117203263-117203285 GGTTGTAAGAGGATTGAAGAGGG + Intronic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914228056 1:145738355-145738377 GACTGTAAAGGGATTGGAAAAGG - Intronic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915874544 1:159598671-159598693 GTATCTCAAGGGATTGCAGATGG - Intergenic
915956649 1:160225819-160225841 GTTTGGAAATGGATTGGAAAAGG - Intronic
916378062 1:164177859-164177881 GTTTGCAAAGAGATTTTTGAGGG - Intergenic
916850007 1:168694110-168694132 GTTTATAAAGGGATTTTCTAAGG - Intergenic
917090614 1:171349932-171349954 GATTTTAAGGGGATTGTGGAGGG + Intergenic
917150465 1:171938326-171938348 GTTTGTACAGGGATTTCAGTAGG - Intronic
917745607 1:178003829-178003851 GTTTGTGGAGGGAGTGTGGAGGG + Intergenic
922347801 1:224711204-224711226 GTTTCAAAAAGGATAGTAGATGG - Intronic
924034552 1:239923172-239923194 GTTTTTAAGGGGATTATGGAAGG + Intergenic
924328693 1:242921251-242921273 GTTTTTAAGGGAATTATAGAAGG + Intergenic
1064376663 10:14802557-14802579 TTTTTTAAAGGGATTGTAGGGGG + Intergenic
1066012738 10:31209518-31209540 GTGTGTAAAGGGATTCTCTATGG - Intergenic
1066494298 10:35927371-35927393 GTTTGTTAAGTGAGTGAAGATGG + Intergenic
1067784718 10:49237042-49237064 GTTGGTAGAGGAATTGGAGAAGG - Intergenic
1068239226 10:54283225-54283247 GTTTGAAGAGGAATAGTAGAAGG + Intronic
1069758344 10:70788199-70788221 GTTTTTAAAGGAACTGTAAATGG + Intergenic
1070852604 10:79579476-79579498 ATTTTTAAAGTGATTGTAAATGG - Intergenic
1071381706 10:85070678-85070700 GCTTGTAAAGCTATTGTAAAAGG - Intergenic
1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG + Intergenic
1077864751 11:6212775-6212797 GTTTGAAAAGAAATTGTAGGAGG - Intronic
1079036059 11:17021140-17021162 GCTTTTAAGGGGATTGTGGAGGG - Intergenic
1079700956 11:23546829-23546851 GTTTTTTAAGTGATTGTAAATGG + Intergenic
1082170722 11:49001818-49001840 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1082197604 11:49323931-49323953 GGTTGTAGAGGGGTTGTGGAGGG + Intergenic
1083084358 11:60127289-60127311 GTTTGTAAGGGGCTAGGAGATGG + Intergenic
1086047517 11:82550105-82550127 GTTATTAAAGGGTTTTTAGATGG - Intergenic
1086330860 11:85752811-85752833 ATTTGTCAAGGGACTGTACATGG - Intronic
1086658222 11:89384196-89384218 GGTTGTAGAGGGGTTGTGGAGGG - Intronic
1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG + Intergenic
1086711067 11:90009942-90009964 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1087786712 11:102363288-102363310 ATTTGTGATGGGATTGGAGAAGG + Intronic
1088164808 11:106921554-106921576 CTTTGTGAAGGAATTGGAGAAGG - Intronic
1091464508 12:671949-671971 GTTTTTAAAGATATTTTAGATGG + Intergenic
1092605667 12:10115741-10115763 GTTTGAAAATAGACTGTAGAGGG + Intergenic
1096683472 12:53272497-53272519 GTTTGTAAAATGAGTGCAGATGG + Intronic
1099631825 12:85158512-85158534 AGTTGAAAAGGGATTGTACAAGG + Intronic
1099738209 12:86597787-86597809 CTTTTTAAAGGGATTGTGGATGG - Intronic
1101261429 12:103034903-103034925 GTGTGTAAAAGGATTCTAGTTGG + Intergenic
1101770013 12:107740860-107740882 CTTTGTAGAGGGATTGTAGGTGG - Intronic
1101770015 12:107740871-107740893 GGTAGTAAAGGCTTTGTAGAGGG - Intronic
1102064357 12:109961243-109961265 GTTTGGAAAGGAATAGTAGTTGG - Intronic
1106199544 13:27524768-27524790 GTTAGAAAAGGGATTGAAAATGG + Intergenic
1106946884 13:34838099-34838121 GTAAGTGAAGGGGTTGTAGAAGG + Intergenic
1108404630 13:50087766-50087788 TTTTATAAAGGGAATGTAGATGG - Intronic
1109819021 13:67627121-67627143 GAATGTAAAGTGATTGGAGAAGG - Intergenic
1110577333 13:77073771-77073793 ATTTGTAAAGCTATTGTAAATGG - Intronic
1111256427 13:85675635-85675657 GTCTTTAAAGGGATTAGAGAGGG - Intergenic
1111998225 13:95185979-95186001 TTTTTTAAAGGGAGTGGAGAAGG + Intronic
1112145281 13:96693045-96693067 GTATGAATTGGGATTGTAGATGG - Intronic
1113047473 13:106171151-106171173 GTTTTTAAAAGGATTTGAGAAGG + Intergenic
1113313197 13:109152677-109152699 GTTTCTAAAGCTATTGCAGAGGG - Intronic
1114883241 14:26813098-26813120 GCTTGCAGAGGTATTGTAGATGG + Intergenic
1114958049 14:27848338-27848360 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1115264733 14:31489326-31489348 GTTTTAAAAGGGATTTTAAAAGG + Intergenic
1116934154 14:50720695-50720717 ATTTGTGAAGGGAGAGTAGAAGG - Intronic
1117895642 14:60483533-60483555 CTATGTAAAGGGATTATAGGAGG - Intronic
1118134845 14:63011916-63011938 GTTGGATAAGGGATTGTAAATGG + Intronic
1118790322 14:69085731-69085753 TTTTGTAAAGAGAAGGTAGAGGG - Intronic
1118810991 14:69273477-69273499 GTCTGTAAAGGGCTTGGAAAGGG + Intronic
1119075899 14:71638881-71638903 GTTTGTTTAGGGATTGCAAATGG - Intronic
1119298320 14:73551255-73551277 GTTTTTAAAGGGATCATGGAGGG - Intronic
1119302616 14:73583442-73583464 GTTTTTAAAGGGATCATGGAGGG - Intergenic
1119537424 14:75413861-75413883 GTTTGGAAAGGGAACATAGATGG + Intergenic
1120702077 14:87709039-87709061 GTTTTTAAAGAAAGTGTAGAGGG + Intergenic
1120713918 14:87820015-87820037 AATTGTAAAGTCATTGTAGAGGG + Intergenic
1122672238 14:103381714-103381736 ATATGAAAAGGGATTGAAGAAGG + Intergenic
1124823309 15:33068867-33068889 GTTGGCACAGGGAGTGTAGAGGG - Intronic
1124988215 15:34644245-34644267 GTTTTTAAAGGGATCATCGAAGG + Intergenic
1125358719 15:38843605-38843627 GTTTGGAAAAGGATGGTAGTGGG + Intergenic
1126545098 15:49864655-49864677 CTTTTTTAAGGGATTTTAGAGGG + Intronic
1129246563 15:74282528-74282550 GCTTTTAGAGGGATTTTAGAGGG + Intronic
1130351987 15:83100895-83100917 GTTTGAAAAAGGGTTGTATATGG - Intergenic
1130741586 15:86606285-86606307 GTTTCTAAGGAGATTGTGGAAGG - Intronic
1135009796 16:18865002-18865024 GTGTGGAAAGGCTTTGTAGAAGG + Intronic
1135302266 16:21340737-21340759 GTTTGTGAAGGATTTGAAGATGG + Intergenic
1136313501 16:29432633-29432655 GTGTGGAAAGGCTTTGTAGAAGG + Intergenic
1136326942 16:29534399-29534421 GTGTGGAAAGGCTTTGTAGAAGG + Intergenic
1136441633 16:30274383-30274405 GTGTGGAAAGGCTTTGTAGAAGG + Intergenic
1136563575 16:31055986-31056008 GTTTCTAAGGGGACTGTGGAGGG + Intergenic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1139162736 16:64531479-64531501 CTTTCCAAAGGGATTGGAGATGG + Intergenic
1139888425 16:70228116-70228138 GTGTGGAAAGGCTTTGTAGAAGG + Intergenic
1141300792 16:82813768-82813790 GTTAGTAAAGGTCCTGTAGATGG - Intronic
1144071848 17:11681151-11681173 GTTTATAAAGGGATGATAGGTGG + Intronic
1148220774 17:45860261-45860283 GTCTCTAAGGGGATTGTGGAGGG + Intergenic
1148731613 17:49840136-49840158 GTTTGTGAAGGGAGAGCAGAGGG - Intronic
1151520656 17:74627019-74627041 ACTTTTAAGGGGATTGTAGAGGG + Intergenic
1152025759 17:77808060-77808082 GGTTGTCAAGTGATTGCAGAGGG + Intergenic
1157566384 18:48681490-48681512 GTCTGTAATGGGGTTGTAGGTGG - Intronic
1158872632 18:61703147-61703169 GTTTTTAAGGGGATTCTGGAGGG - Intergenic
1159624411 18:70675384-70675406 GTGTGTAAAGGGATGGGGGAAGG + Intergenic
1167191956 19:47996677-47996699 GTTGGTAAAGGGATGGTTGATGG + Intronic
1167856894 19:52249094-52249116 GTCAGTAAAGGGGTTATAGAAGG + Intergenic
926201119 2:10798648-10798670 GATTCTAAAGGGCTTGTTGAGGG - Intronic
926489698 2:13508973-13508995 TTTTGTAAAAGGATTGTAGAAGG + Intergenic
930237131 2:48899263-48899285 GCTTGTAATGGGATTTTAAAAGG + Intergenic
930660158 2:54045246-54045268 GTTTTTAAGGGGATCGTGGAGGG - Intronic
930947594 2:57093460-57093482 GATTGCCAAGGGATTGGAGAGGG + Intergenic
933517843 2:83328803-83328825 GTTTTTACAGGTATTGTAAAAGG - Intergenic
934479252 2:94619706-94619728 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
935535339 2:104286883-104286905 GTTTGAAGAGGGTTTGGAGAAGG + Intergenic
935836053 2:107055047-107055069 TTTTTTAAAGTGATTGTCGATGG + Intergenic
940605385 2:155917158-155917180 GTTTGAAAATGTAATGTAGAGGG + Intergenic
941501742 2:166287149-166287171 TTTTGTAAAGGGATAGTACTAGG - Intronic
941510933 2:166408338-166408360 GCTTTTAAATGGATTGTTGATGG - Intronic
941960074 2:171244715-171244737 GTTTGTAAGGGGTTTGGAGTGGG + Intergenic
942489409 2:176474747-176474769 TGTTGGGAAGGGATTGTAGAGGG + Intergenic
943892334 2:193305936-193305958 GTTGTTATATGGATTGTAGATGG - Intergenic
944708505 2:202314736-202314758 GTATGTAAAGGGATTAAACAAGG + Intergenic
945034062 2:205689005-205689027 GTGTGTACAGGGAGTGGAGAAGG + Intronic
946497768 2:220213276-220213298 ATTGGCAAAGGGATTGCAGAAGG - Intergenic
1170816247 20:19716951-19716973 GTTAGTAAAGGGATTTTTGGAGG - Intronic
1173856365 20:46252880-46252902 GTTTGGAAAGGGAAAGTAGGCGG + Intronic
1173972615 20:47164329-47164351 ATTTGTAAGGGGATTGTTGGGGG - Intronic
1178085685 21:29109703-29109725 GTTTGTATAAGGTTTGTATAAGG - Intronic
1183283510 22:36947561-36947583 GTTTTTAAGGGGATTATAGAGGG - Intergenic
1183834084 22:40437612-40437634 TTTTGTACAGGCATGGTAGAGGG + Intronic
1183939492 22:41285349-41285371 GTTTATAAAGTGAGTGTGGAGGG - Intronic
1184788954 22:46687467-46687489 GTTTGTAAAGGGGTTGCCAATGG + Intronic
952466198 3:33588793-33588815 GTTTTTAAATGGATGGCAGATGG + Intronic
952559706 3:34577076-34577098 GATTTTGAAGGGATTGGAGATGG + Intergenic
952647693 3:35681507-35681529 GTGTGTAAAGGGGGTGTGGATGG + Intronic
952942089 3:38453374-38453396 GTGTGGCAAGGGATTGCAGACGG + Intergenic
955817870 3:62864916-62864938 GTATGTAAAGTCATTTTAGATGG - Intronic
958744583 3:98116678-98116700 GTTTGCAGAGGGATTGTGAATGG + Intergenic
961888906 3:130113839-130113861 GATTGGAAACGGATTGAAGAAGG + Intergenic
961960153 3:130846198-130846220 GGTTGTAATGGGAATATAGAGGG + Intergenic
963413588 3:144963856-144963878 TTTTGTAAAGGTTTTGTAAATGG + Intergenic
964643561 3:158934772-158934794 GTTTCTTAAGGCAATGTAGATGG + Intergenic
966398279 3:179523425-179523447 GGTTGTGGAGGGATTGTGGAGGG + Intergenic
967500965 3:190196940-190196962 GTTTGTAAAAATATTGCAGAAGG - Intergenic
970932373 4:21527687-21527709 GTTTTTCAAGGCATTGTAAATGG - Intronic
971117744 4:23667719-23667741 GTTAGTGAAGGGTTTATAGAGGG - Intergenic
971458135 4:26863127-26863149 GTCTTAAAAGGGATTGTAAATGG - Intronic
974480538 4:62437581-62437603 GTTTTTAAGGGGATTATGGAGGG + Intergenic
974595385 4:64008106-64008128 GTTTGTAAAGGGATCCTGGAAGG - Intergenic
975144417 4:70951994-70952016 GTTGTTAATGGGATTGTAAAAGG + Intronic
976665805 4:87589807-87589829 ATTTTTAAAGAGATTGTGGAAGG - Intergenic
977003760 4:91538625-91538647 GTTTGTATAGGGATTGTTTGGGG - Intronic
977588695 4:98803348-98803370 GCTTTTAAAGGGAATCTAGATGG - Intergenic
978579176 4:110215640-110215662 GTTTTTAAGGGGATCGTAGAGGG + Intergenic
980398690 4:132250571-132250593 GATTGTAAAGGGGCTGTAAAGGG - Intergenic
980475541 4:133309922-133309944 GCTTATAAAAGGATTGAAGAGGG + Intergenic
980832789 4:138152053-138152075 CTTTGTAAAAGGAAGGTAGAAGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
992544689 5:77801136-77801158 GATTGTAAAGAGAATGTATATGG + Intronic
993824640 5:92667782-92667804 TTATGTAAAGGGAGTGTAAATGG - Intergenic
996276185 5:121668725-121668747 GTTTTTAAGGGGATCGTGGAGGG + Intergenic
996556409 5:124783342-124783364 GTTTAAAAAGTGTTTGTAGATGG + Intergenic
997092075 5:130869878-130869900 GTTTAGAAAGGCTTTGTAGATGG - Intergenic
1000219161 5:159195456-159195478 GTTTGTAAAGGGATTGTAGATGG - Intronic
1002692260 5:181058772-181058794 GTTTTTAAAAGGATTTTAAAAGG - Intronic
1004519448 6:16347842-16347864 GTGTGGAAAGGGATCGGAGAAGG - Intronic
1004695937 6:18033106-18033128 TTTTATAAATGGATTGTTGAGGG + Intergenic
1005582294 6:27246895-27246917 GTTTGAAAAGGAATAGAAGAGGG + Intergenic
1006519206 6:34561846-34561868 GTTTGTAGAGGGGTAGGAGATGG - Intergenic
1009774560 6:68189268-68189290 GTTTGTAAAATGAATTTAGAGGG - Intergenic
1011138292 6:84123875-84123897 GTTTGTAACGGGATTGTTTGGGG - Intergenic
1012229258 6:96741130-96741152 TTTTCTAAAGGTATTATAGAAGG + Intergenic
1013053082 6:106555993-106556015 GTTAGTTAAGGGCTTGGAGATGG + Intronic
1013900011 6:115143850-115143872 GTTGGTAATGAGATTGCAGATGG - Intergenic
1014672764 6:124327216-124327238 GTTTCTAAAGGAATTTTGGAGGG + Intronic
1014749336 6:125237256-125237278 TGTTGAAAAGGGACTGTAGAAGG + Intronic
1015566111 6:134573485-134573507 GTTTGTTAAGGCATTGGGGATGG + Intergenic
1020660796 7:10979208-10979230 TATTGTAAAGGGATTCTTGAAGG + Intronic
1021172837 7:17417054-17417076 GGTTATAGAGGGGTTGTAGAGGG - Intergenic
1021957100 7:25836472-25836494 GTTTTTAAAGAGATTGTCCAAGG - Intergenic
1024324796 7:48101203-48101225 GTTTTTAAAGAGTTTGAAGATGG - Intronic
1025973285 7:66348693-66348715 GTTTGTATAGGCAATGTAGTGGG + Intronic
1026018516 7:66690781-66690803 GTTATTAAAAGGATTGTATAAGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1027701158 7:81471670-81471692 GGTTGTCAAGGGAATGAAGAAGG - Intergenic
1032176322 7:129630503-129630525 TTTTCAAAAGGGATTATAGAAGG + Intronic
1032951795 7:136922887-136922909 CTTTACAAAGGGATCGTAGAAGG + Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1036498575 8:9293306-9293328 CTATCTAAAGGGATTGTTGAGGG + Intergenic
1037106441 8:15113755-15113777 GATTGTAGGAGGATTGTAGAGGG - Intronic
1037221688 8:16530334-16530356 GTTTGCTAAAGAATTGTAGAGGG - Intronic
1042932802 8:74030171-74030193 GTTTTTAAAGGGAAAGAAGAGGG + Intergenic
1043191917 8:77235422-77235444 GTTTTTAAAGGGGGTGTGGAGGG + Intergenic
1044829494 8:96232876-96232898 GTTGGGAAAGGGGGTGTAGAAGG + Intronic
1045147872 8:99367964-99367986 ATTTTTAAAGGGATTGGGGAAGG + Intronic
1048163964 8:132045682-132045704 GTAAGTAAAGGGATTGAAGTGGG - Intronic
1049639685 8:143709397-143709419 GTTTTTAAAGGGATTGTGGCGGG - Intronic
1051815180 9:21096314-21096336 GTTTGTGAAGGGAATGGAGCTGG - Intergenic
1051850197 9:21497681-21497703 GTTTTTAAATTGTTTGTAGAGGG - Intergenic
1052163204 9:25290603-25290625 GGTTGTAATGGGATGGTAAAGGG - Intergenic
1052596618 9:30568780-30568802 GTTTGGAAAGATATTGTAGTTGG + Intergenic
1052732625 9:32307470-32307492 ATTTTTAAGGGGATTGTGGAGGG - Intergenic
1053678577 9:40463859-40463881 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1053928562 9:43092213-43092235 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054285147 9:63161083-63161105 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054291655 9:63299397-63299419 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054389671 9:64603940-64603962 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054506041 9:65912436-65912458 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054840483 9:69733201-69733223 GTTTGGAAAGGGATGGTGGCAGG - Intronic
1054860340 9:69945937-69945959 GTTTGTGAAGACATTGCAGATGG + Intergenic
1056579287 9:87878724-87878746 GTTTTTAAGGAGATTGTGGAGGG - Intergenic
1057249173 9:93485800-93485822 GTTGGCCAAGGGGTTGTAGAGGG - Intronic
1059934790 9:119298822-119298844 GTATGTAAAGGGAAAGGAGAGGG - Intronic
1186225632 X:7396134-7396156 GCTTTTAAGGGGATTGTGGAGGG + Intergenic
1187730595 X:22249862-22249884 GTTTATAAAGGAAATCTAGAAGG - Exonic
1189190972 X:39105368-39105390 GTTTGTCAAGGATTTGGAGAGGG + Intergenic
1189906281 X:45763356-45763378 GTTCCTAAAGGGATTTTGGAAGG + Intergenic
1190287859 X:48972400-48972422 GAGGGTAAAGGGAATGTAGAGGG + Intergenic
1190926217 X:54907616-54907638 ATAAGTAAAGGGATGGTAGATGG - Intergenic
1192369659 X:70502958-70502980 GGTTGGGAAGGGATTGAAGATGG + Exonic
1193367259 X:80650151-80650173 GTTTGTCAGGGCATAGTAGAGGG - Intergenic
1194010978 X:88560587-88560609 AATTGTAAAGGGATTTTAAATGG - Intergenic
1194216857 X:91140873-91140895 GTCTGTGAAGGGATAGTGGAGGG - Intergenic
1194322116 X:92461149-92461171 GTTTTGATAGGAATTGTAGATGG - Intronic
1195390587 X:104358071-104358093 GTTTTTAAGCGGATTGTGGAGGG + Intergenic
1195527685 X:105910678-105910700 GTTTTTAAGGGGATTGTAGAGGG + Intronic
1195825913 X:109000514-109000536 ATTTTTAAAGGGATTCTAGGTGG - Intergenic
1198455577 X:136814469-136814491 GTTGGAAGAGGGATTGCAGAAGG - Intergenic
1199427571 X:147720676-147720698 GTTTATGTAGGGATTGTACAAGG + Intergenic
1200630279 Y:5574626-5574648 GTTTTGATAGGAATTGTAGATGG - Intronic