ID: 1000220177

View in Genome Browser
Species Human (GRCh38)
Location 5:159208172-159208194
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 96}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000220177_1000220184 25 Left 1000220177 5:159208172-159208194 CCCAACCCAGCTCGCGGCAAGCA 0: 1
1: 0
2: 1
3: 2
4: 96
Right 1000220184 5:159208220-159208242 CAACCGGGCCGCCGCCGCCGCGG No data
1000220177_1000220186 27 Left 1000220177 5:159208172-159208194 CCCAACCCAGCTCGCGGCAAGCA 0: 1
1: 0
2: 1
3: 2
4: 96
Right 1000220186 5:159208222-159208244 ACCGGGCCGCCGCCGCCGCGGGG 0: 1
1: 0
2: 5
3: 43
4: 244
1000220177_1000220183 10 Left 1000220177 5:159208172-159208194 CCCAACCCAGCTCGCGGCAAGCA 0: 1
1: 0
2: 1
3: 2
4: 96
Right 1000220183 5:159208205-159208227 CAGCAGTAGCAGCAGCAACCGGG 0: 1
1: 4
2: 33
3: 181
4: 747
1000220177_1000220185 26 Left 1000220177 5:159208172-159208194 CCCAACCCAGCTCGCGGCAAGCA 0: 1
1: 0
2: 1
3: 2
4: 96
Right 1000220185 5:159208221-159208243 AACCGGGCCGCCGCCGCCGCGGG 0: 1
1: 0
2: 4
3: 22
4: 162
1000220177_1000220182 9 Left 1000220177 5:159208172-159208194 CCCAACCCAGCTCGCGGCAAGCA 0: 1
1: 0
2: 1
3: 2
4: 96
Right 1000220182 5:159208204-159208226 GCAGCAGTAGCAGCAGCAACCGG 0: 1
1: 9
2: 141
3: 347
4: 1124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000220177 Original CRISPR TGCTTGCCGCGAGCTGGGTT GGG (reversed) Intronic