ID: 1000220180

View in Genome Browser
Species Human (GRCh38)
Location 5:159208177-159208199
Sequence CTGCCTGCTTGCCGCGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000220180_1000220184 20 Left 1000220180 5:159208177-159208199 CCCAGCTCGCGGCAAGCAGGCAG No data
Right 1000220184 5:159208220-159208242 CAACCGGGCCGCCGCCGCCGCGG No data
1000220180_1000220185 21 Left 1000220180 5:159208177-159208199 CCCAGCTCGCGGCAAGCAGGCAG No data
Right 1000220185 5:159208221-159208243 AACCGGGCCGCCGCCGCCGCGGG 0: 1
1: 0
2: 4
3: 22
4: 162
1000220180_1000220182 4 Left 1000220180 5:159208177-159208199 CCCAGCTCGCGGCAAGCAGGCAG No data
Right 1000220182 5:159208204-159208226 GCAGCAGTAGCAGCAGCAACCGG 0: 1
1: 9
2: 141
3: 347
4: 1124
1000220180_1000220186 22 Left 1000220180 5:159208177-159208199 CCCAGCTCGCGGCAAGCAGGCAG No data
Right 1000220186 5:159208222-159208244 ACCGGGCCGCCGCCGCCGCGGGG 0: 1
1: 0
2: 5
3: 43
4: 244
1000220180_1000220183 5 Left 1000220180 5:159208177-159208199 CCCAGCTCGCGGCAAGCAGGCAG No data
Right 1000220183 5:159208205-159208227 CAGCAGTAGCAGCAGCAACCGGG 0: 1
1: 4
2: 33
3: 181
4: 747

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000220180 Original CRISPR CTGCCTGCTTGCCGCGAGCT GGG (reversed) Intronic