ID: 1000220182

View in Genome Browser
Species Human (GRCh38)
Location 5:159208204-159208226
Sequence GCAGCAGTAGCAGCAGCAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1622
Summary {0: 1, 1: 9, 2: 141, 3: 347, 4: 1124}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000220181_1000220182 3 Left 1000220181 5:159208178-159208200 CCAGCTCGCGGCAAGCAGGCAGC 0: 1
1: 0
2: 2
3: 7
4: 95
Right 1000220182 5:159208204-159208226 GCAGCAGTAGCAGCAGCAACCGG 0: 1
1: 9
2: 141
3: 347
4: 1124
1000220180_1000220182 4 Left 1000220180 5:159208177-159208199 CCCAGCTCGCGGCAAGCAGGCAG No data
Right 1000220182 5:159208204-159208226 GCAGCAGTAGCAGCAGCAACCGG 0: 1
1: 9
2: 141
3: 347
4: 1124
1000220177_1000220182 9 Left 1000220177 5:159208172-159208194 CCCAACCCAGCTCGCGGCAAGCA 0: 1
1: 0
2: 1
3: 2
4: 96
Right 1000220182 5:159208204-159208226 GCAGCAGTAGCAGCAGCAACCGG 0: 1
1: 9
2: 141
3: 347
4: 1124
1000220176_1000220182 10 Left 1000220176 5:159208171-159208193 CCCCAACCCAGCTCGCGGCAAGC 0: 1
1: 0
2: 1
3: 5
4: 112
Right 1000220182 5:159208204-159208226 GCAGCAGTAGCAGCAGCAACCGG 0: 1
1: 9
2: 141
3: 347
4: 1124
1000220178_1000220182 8 Left 1000220178 5:159208173-159208195 CCAACCCAGCTCGCGGCAAGCAG No data
Right 1000220182 5:159208204-159208226 GCAGCAGTAGCAGCAGCAACCGG 0: 1
1: 9
2: 141
3: 347
4: 1124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000220182 Original CRISPR GCAGCAGTAGCAGCAGCAAC CGG Intronic