ID: 1000220183

View in Genome Browser
Species Human (GRCh38)
Location 5:159208205-159208227
Sequence CAGCAGTAGCAGCAGCAACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 966
Summary {0: 1, 1: 4, 2: 33, 3: 181, 4: 747}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000220177_1000220183 10 Left 1000220177 5:159208172-159208194 CCCAACCCAGCTCGCGGCAAGCA 0: 1
1: 0
2: 1
3: 2
4: 96
Right 1000220183 5:159208205-159208227 CAGCAGTAGCAGCAGCAACCGGG 0: 1
1: 4
2: 33
3: 181
4: 747
1000220180_1000220183 5 Left 1000220180 5:159208177-159208199 CCCAGCTCGCGGCAAGCAGGCAG No data
Right 1000220183 5:159208205-159208227 CAGCAGTAGCAGCAGCAACCGGG 0: 1
1: 4
2: 33
3: 181
4: 747
1000220181_1000220183 4 Left 1000220181 5:159208178-159208200 CCAGCTCGCGGCAAGCAGGCAGC 0: 1
1: 0
2: 2
3: 7
4: 95
Right 1000220183 5:159208205-159208227 CAGCAGTAGCAGCAGCAACCGGG 0: 1
1: 4
2: 33
3: 181
4: 747
1000220176_1000220183 11 Left 1000220176 5:159208171-159208193 CCCCAACCCAGCTCGCGGCAAGC 0: 1
1: 0
2: 1
3: 5
4: 112
Right 1000220183 5:159208205-159208227 CAGCAGTAGCAGCAGCAACCGGG 0: 1
1: 4
2: 33
3: 181
4: 747
1000220178_1000220183 9 Left 1000220178 5:159208173-159208195 CCAACCCAGCTCGCGGCAAGCAG No data
Right 1000220183 5:159208205-159208227 CAGCAGTAGCAGCAGCAACCGGG 0: 1
1: 4
2: 33
3: 181
4: 747

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000220183 Original CRISPR CAGCAGTAGCAGCAGCAACC GGG Intronic