ID: 1000220185

View in Genome Browser
Species Human (GRCh38)
Location 5:159208221-159208243
Sequence AACCGGGCCGCCGCCGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 162}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000220181_1000220185 20 Left 1000220181 5:159208178-159208200 CCAGCTCGCGGCAAGCAGGCAGC 0: 1
1: 0
2: 2
3: 7
4: 95
Right 1000220185 5:159208221-159208243 AACCGGGCCGCCGCCGCCGCGGG 0: 1
1: 0
2: 4
3: 22
4: 162
1000220180_1000220185 21 Left 1000220180 5:159208177-159208199 CCCAGCTCGCGGCAAGCAGGCAG No data
Right 1000220185 5:159208221-159208243 AACCGGGCCGCCGCCGCCGCGGG 0: 1
1: 0
2: 4
3: 22
4: 162
1000220176_1000220185 27 Left 1000220176 5:159208171-159208193 CCCCAACCCAGCTCGCGGCAAGC 0: 1
1: 0
2: 1
3: 5
4: 112
Right 1000220185 5:159208221-159208243 AACCGGGCCGCCGCCGCCGCGGG 0: 1
1: 0
2: 4
3: 22
4: 162
1000220178_1000220185 25 Left 1000220178 5:159208173-159208195 CCAACCCAGCTCGCGGCAAGCAG No data
Right 1000220185 5:159208221-159208243 AACCGGGCCGCCGCCGCCGCGGG 0: 1
1: 0
2: 4
3: 22
4: 162
1000220177_1000220185 26 Left 1000220177 5:159208172-159208194 CCCAACCCAGCTCGCGGCAAGCA 0: 1
1: 0
2: 1
3: 2
4: 96
Right 1000220185 5:159208221-159208243 AACCGGGCCGCCGCCGCCGCGGG 0: 1
1: 0
2: 4
3: 22
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000220185 Original CRISPR AACCGGGCCGCCGCCGCCGC GGG Intronic