ID: 1000220460

View in Genome Browser
Species Human (GRCh38)
Location 5:159209309-159209331
Sequence CGCCGCCCGAGGAGAACGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 3, 1: 0, 2: 0, 3: 13, 4: 71}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000220460_1000220473 8 Left 1000220460 5:159209309-159209331 CCTCCCGTTCTCCTCGGGCGGCG 0: 3
1: 0
2: 0
3: 13
4: 71
Right 1000220473 5:159209340-159209362 CGGTACGGCACGGCTCACAGCGG 0: 1
1: 0
2: 0
3: 0
4: 16
1000220460_1000220474 11 Left 1000220460 5:159209309-159209331 CCTCCCGTTCTCCTCGGGCGGCG 0: 3
1: 0
2: 0
3: 13
4: 71
Right 1000220474 5:159209343-159209365 TACGGCACGGCTCACAGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 22
1000220460_1000220470 -7 Left 1000220460 5:159209309-159209331 CCTCCCGTTCTCCTCGGGCGGCG 0: 3
1: 0
2: 0
3: 13
4: 71
Right 1000220470 5:159209325-159209347 GGCGGCGGCGGGGGCCGGTACGG 0: 1
1: 1
2: 13
3: 134
4: 1159
1000220460_1000220471 -2 Left 1000220460 5:159209309-159209331 CCTCCCGTTCTCCTCGGGCGGCG 0: 3
1: 0
2: 0
3: 13
4: 71
Right 1000220471 5:159209330-159209352 CGGCGGGGGCCGGTACGGCACGG 0: 1
1: 0
2: 0
3: 8
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000220460 Original CRISPR CGCCGCCCGAGGAGAACGGG AGG (reversed) Intronic