ID: 1000223242

View in Genome Browser
Species Human (GRCh38)
Location 5:159234232-159234254
Sequence CTTGGCTTGTTACTGGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000223242_1000223250 23 Left 1000223242 5:159234232-159234254 CCAAAGCCCAGTAACAAGCCAAG No data
Right 1000223250 5:159234278-159234300 GGTATCTGCAGAAGATGGCAGGG No data
1000223242_1000223245 -6 Left 1000223242 5:159234232-159234254 CCAAAGCCCAGTAACAAGCCAAG No data
Right 1000223245 5:159234249-159234271 GCCAAGAGCTGTGTCTCAAAAGG No data
1000223242_1000223249 22 Left 1000223242 5:159234232-159234254 CCAAAGCCCAGTAACAAGCCAAG No data
Right 1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG No data
1000223242_1000223248 18 Left 1000223242 5:159234232-159234254 CCAAAGCCCAGTAACAAGCCAAG No data
Right 1000223248 5:159234273-159234295 GAGTAGGTATCTGCAGAAGATGG No data
1000223242_1000223247 2 Left 1000223242 5:159234232-159234254 CCAAAGCCCAGTAACAAGCCAAG No data
Right 1000223247 5:159234257-159234279 CTGTGTCTCAAAAGGAGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000223242 Original CRISPR CTTGGCTTGTTACTGGGCTT TGG (reversed) Intergenic
No off target data available for this crispr