ID: 1000223243

View in Genome Browser
Species Human (GRCh38)
Location 5:159234238-159234260
Sequence ACAGCTCTTGGCTTGTTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000223243_1000223250 17 Left 1000223243 5:159234238-159234260 CCCAGTAACAAGCCAAGAGCTGT No data
Right 1000223250 5:159234278-159234300 GGTATCTGCAGAAGATGGCAGGG No data
1000223243_1000223247 -4 Left 1000223243 5:159234238-159234260 CCCAGTAACAAGCCAAGAGCTGT No data
Right 1000223247 5:159234257-159234279 CTGTGTCTCAAAAGGAGAGTAGG No data
1000223243_1000223248 12 Left 1000223243 5:159234238-159234260 CCCAGTAACAAGCCAAGAGCTGT No data
Right 1000223248 5:159234273-159234295 GAGTAGGTATCTGCAGAAGATGG No data
1000223243_1000223249 16 Left 1000223243 5:159234238-159234260 CCCAGTAACAAGCCAAGAGCTGT No data
Right 1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000223243 Original CRISPR ACAGCTCTTGGCTTGTTACT GGG (reversed) Intergenic
No off target data available for this crispr