ID: 1000223244

View in Genome Browser
Species Human (GRCh38)
Location 5:159234239-159234261
Sequence CACAGCTCTTGGCTTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000223244_1000223248 11 Left 1000223244 5:159234239-159234261 CCAGTAACAAGCCAAGAGCTGTG No data
Right 1000223248 5:159234273-159234295 GAGTAGGTATCTGCAGAAGATGG No data
1000223244_1000223250 16 Left 1000223244 5:159234239-159234261 CCAGTAACAAGCCAAGAGCTGTG No data
Right 1000223250 5:159234278-159234300 GGTATCTGCAGAAGATGGCAGGG No data
1000223244_1000223247 -5 Left 1000223244 5:159234239-159234261 CCAGTAACAAGCCAAGAGCTGTG No data
Right 1000223247 5:159234257-159234279 CTGTGTCTCAAAAGGAGAGTAGG No data
1000223244_1000223249 15 Left 1000223244 5:159234239-159234261 CCAGTAACAAGCCAAGAGCTGTG No data
Right 1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000223244 Original CRISPR CACAGCTCTTGGCTTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr