ID: 1000223246

View in Genome Browser
Species Human (GRCh38)
Location 5:159234250-159234272
Sequence TCCTTTTGAGACACAGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000223246_1000223249 4 Left 1000223246 5:159234250-159234272 CCAAGAGCTGTGTCTCAAAAGGA No data
Right 1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG No data
1000223246_1000223251 27 Left 1000223246 5:159234250-159234272 CCAAGAGCTGTGTCTCAAAAGGA No data
Right 1000223251 5:159234300-159234322 GCCTTGCTCCAAAATCCTAGAGG 0: 143
1: 187
2: 148
3: 132
4: 240
1000223246_1000223248 0 Left 1000223246 5:159234250-159234272 CCAAGAGCTGTGTCTCAAAAGGA No data
Right 1000223248 5:159234273-159234295 GAGTAGGTATCTGCAGAAGATGG No data
1000223246_1000223250 5 Left 1000223246 5:159234250-159234272 CCAAGAGCTGTGTCTCAAAAGGA No data
Right 1000223250 5:159234278-159234300 GGTATCTGCAGAAGATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000223246 Original CRISPR TCCTTTTGAGACACAGCTCT TGG (reversed) Intergenic
No off target data available for this crispr