ID: 1000223247

View in Genome Browser
Species Human (GRCh38)
Location 5:159234257-159234279
Sequence CTGTGTCTCAAAAGGAGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000223240_1000223247 26 Left 1000223240 5:159234208-159234230 CCATAATCAAGCCTTCAGTTTCT No data
Right 1000223247 5:159234257-159234279 CTGTGTCTCAAAAGGAGAGTAGG No data
1000223241_1000223247 15 Left 1000223241 5:159234219-159234241 CCTTCAGTTTCTACCAAAGCCCA No data
Right 1000223247 5:159234257-159234279 CTGTGTCTCAAAAGGAGAGTAGG No data
1000223243_1000223247 -4 Left 1000223243 5:159234238-159234260 CCCAGTAACAAGCCAAGAGCTGT No data
Right 1000223247 5:159234257-159234279 CTGTGTCTCAAAAGGAGAGTAGG No data
1000223244_1000223247 -5 Left 1000223244 5:159234239-159234261 CCAGTAACAAGCCAAGAGCTGTG No data
Right 1000223247 5:159234257-159234279 CTGTGTCTCAAAAGGAGAGTAGG No data
1000223239_1000223247 27 Left 1000223239 5:159234207-159234229 CCCATAATCAAGCCTTCAGTTTC No data
Right 1000223247 5:159234257-159234279 CTGTGTCTCAAAAGGAGAGTAGG No data
1000223242_1000223247 2 Left 1000223242 5:159234232-159234254 CCAAAGCCCAGTAACAAGCCAAG No data
Right 1000223247 5:159234257-159234279 CTGTGTCTCAAAAGGAGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000223247 Original CRISPR CTGTGTCTCAAAAGGAGAGT AGG Intergenic
No off target data available for this crispr