ID: 1000223249

View in Genome Browser
Species Human (GRCh38)
Location 5:159234277-159234299
Sequence AGGTATCTGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000223243_1000223249 16 Left 1000223243 5:159234238-159234260 CCCAGTAACAAGCCAAGAGCTGT No data
Right 1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG No data
1000223242_1000223249 22 Left 1000223242 5:159234232-159234254 CCAAAGCCCAGTAACAAGCCAAG No data
Right 1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG No data
1000223244_1000223249 15 Left 1000223244 5:159234239-159234261 CCAGTAACAAGCCAAGAGCTGTG No data
Right 1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG No data
1000223246_1000223249 4 Left 1000223246 5:159234250-159234272 CCAAGAGCTGTGTCTCAAAAGGA No data
Right 1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000223249 Original CRISPR AGGTATCTGCAGAAGATGGC AGG Intergenic
No off target data available for this crispr