ID: 1000223251

View in Genome Browser
Species Human (GRCh38)
Location 5:159234300-159234322
Sequence GCCTTGCTCCAAAATCCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 850
Summary {0: 143, 1: 187, 2: 148, 3: 132, 4: 240}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000223246_1000223251 27 Left 1000223246 5:159234250-159234272 CCAAGAGCTGTGTCTCAAAAGGA No data
Right 1000223251 5:159234300-159234322 GCCTTGCTCCAAAATCCTAGAGG 0: 143
1: 187
2: 148
3: 132
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000223251 Original CRISPR GCCTTGCTCCAAAATCCTAG AGG Intergenic
900434956 1:2625553-2625575 GCCCCGCTCCAAAATCCTAGAGG - Intronic
901857352 1:12052862-12052884 TCCCTGATCCAAACTCCTAGTGG + Intergenic
901904054 1:12392709-12392731 GCCTTCCTCCAAAATCCTAGAGG + Intronic
902758260 1:18563808-18563830 GCCTTGGTCCAAAAGCCCCGAGG - Intergenic
902977001 1:20096011-20096033 GCTTTGCTCCAAAACCCTTAAGG - Intergenic
903120062 1:21210365-21210387 GCCGTGCTTCAAAATCCTAAGGG - Intergenic
904915583 1:33968051-33968073 GCCTTGCCCCATGAGCCTAGTGG + Intronic
905354064 1:37368762-37368784 GCTTTGCTCCAAAATCCTAGAGG - Intergenic
905465222 1:38148074-38148096 GCTTTGCTCCAAAATCCTAGAGG - Intergenic
906050485 1:42867389-42867411 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
906054948 1:42908490-42908512 GCCTTGCTCCAAAATCCCAAAGG + Intergenic
907597343 1:55732105-55732127 GCCTTGCTCTAAAATCCTAGCGG - Intergenic
907602086 1:55782172-55782194 GCTTTGTTCCAAAATCCTAAAGG + Intergenic
907780341 1:57560809-57560831 GCCTTGCTCCAAAATCCTAGAGG - Intronic
908790803 1:67779410-67779432 GCCTTGATCCTAAAACCTAGAGG - Intronic
909172610 1:72315489-72315511 ACCTTGCTCTTAAATCCTAGAGG + Intergenic
909548953 1:76877189-76877211 GCCTTGCTCCAAAATCCTAGAGG + Intronic
909576917 1:77185833-77185855 GCCTTGCTCCAAAATCCTAGAGG - Intronic
909810953 1:79931314-79931336 GCCTTGCTCCAAAATACTAGAGG - Intergenic
910325581 1:86003119-86003141 GCCTTACTCCAGAATTCCAGAGG - Intronic
910561897 1:88599956-88599978 GCCTTGCTCCAAAATCTTAGAGG - Intergenic
910588213 1:88901701-88901723 GCCCTGTTCCAAAATCCTAGAGG - Intergenic
910630217 1:89346227-89346249 GCCTTGCTCCAAAATCCCAGAGG - Intergenic
910638994 1:89439999-89440021 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
910790320 1:91043695-91043717 ACCTTCCTCCAAAATCCTAGAGG - Intergenic
910831103 1:91463449-91463471 GCCTTGCACCAAAATCCTAGGGG + Intergenic
910948211 1:92616663-92616685 GTCTCGCTCCAAAATCCTAGAGG - Intronic
910984560 1:92992974-92992996 ACCTTTCTCCAGAATCCCAGGGG + Intergenic
911109101 1:94164230-94164252 GCCTTGCTCCAAAATCCTAGAGG + Intronic
911257329 1:95647389-95647411 GCCTTTCTCCAAAATCCTAGAGG + Intergenic
911266865 1:95753512-95753534 ACCTTGCTCCGAAATCAGAGTGG - Intergenic
911883567 1:103270424-103270446 GCCCTGTTCCAAAATCCTAGAGG - Intergenic
911980423 1:104559396-104559418 GTCTTGCTTCAAACTCCTAGAGG - Intergenic
911981902 1:104579287-104579309 GCCTTGCACAAAAATCCTAGAGG + Intergenic
912212248 1:107568869-107568891 GTCTTGCTCCAAAATCCTGGAGG - Intergenic
912252033 1:108021413-108021435 GCCTTGCTCCAAAATCCCAGAGG + Intergenic
912733326 1:112128854-112128876 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
912943813 1:114068229-114068251 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
913039448 1:115008420-115008442 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
914889447 1:151609947-151609969 GTTTTGCTCCAAAATAATAGTGG - Intergenic
915667674 1:157459668-157459690 GCCTTACCTCAAAATCCTAGAGG + Intergenic
915961801 1:160273219-160273241 ACCTTACTCCAGAATCCTGGAGG + Intergenic
916017361 1:160762017-160762039 GCATTGCTCCAAAATCCTAAAGG + Intergenic
916037534 1:160934244-160934266 GTCTTACTCTAAAACCCTAGAGG - Intergenic
916106333 1:161435352-161435374 GCCTTGTTCCAAAATCCTAGAGG + Intergenic
916365975 1:164028112-164028134 GCTTTGCTCTAAAATCCTAAGGG + Intergenic
916369826 1:164079773-164079795 GCTTTGCTCCAAAATCCTAAAGG - Intergenic
916380898 1:164209584-164209606 GCTTTGCTTCAAAATTCTAGTGG - Intergenic
916447638 1:164888501-164888523 ACCTTGCTCCAAAATTTTATGGG - Intronic
917052494 1:170939862-170939884 GCTTTGCTCCAAAATCCTGGGGG + Intronic
917217218 1:172690938-172690960 GACTTGCTCCAAAATCCTAGAGG + Intergenic
917276491 1:173337171-173337193 GTTTTGCTCCAAAATCCTAGGGG - Intergenic
917462705 1:175246161-175246183 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
918755719 1:188337834-188337856 GCCTTCCTCCAAAATTCTAGAGG + Intergenic
918774490 1:188610722-188610744 GACTTGCTCCAAATTCCTAGAGG - Intergenic
918815074 1:189171203-189171225 GACTTGCTCCAGAATCCTCGAGG - Intergenic
918820556 1:189249699-189249721 ACTTTGCTCCAAAATCAGAGTGG - Intergenic
918918235 1:190671904-190671926 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
918958239 1:191237924-191237946 GCCTTGCTCCAAAATCCTGGAGG - Intergenic
919124615 1:193379806-193379828 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
919241771 1:194924179-194924201 TCCTTGCTCCAAAATCCTAGAGG - Intergenic
919317969 1:195999337-195999359 AACTTGCTCCAATATCCTAGAGG - Intergenic
919893120 1:201990559-201990581 GCCCTGCTCCCAGTTCCTAGAGG + Intronic
920197425 1:204238341-204238363 GCCTTGCTCCAAAATCCTAGGGG - Intronic
922781050 1:228252606-228252628 GTGTTGTTCCAAAATCCTAAAGG + Intronic
923253572 1:232199462-232199484 GCCTTGTTCCAAAATCCTAACGG + Intergenic
924182510 1:241453270-241453292 GACTTGCTCCAAAATCCTAAAGG + Intergenic
924432241 1:244007165-244007187 GCCTTGCTCCAGAACCCTAGGGG - Intergenic
924491838 1:244545555-244545577 GCCTTTCTCCAAAATACAAAAGG - Intronic
924840780 1:247707857-247707879 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
924847137 1:247785163-247785185 GCGTTGCTCCGAAATCCTAGAGG + Intergenic
1062862491 10:821790-821812 GATTTGCTCCAGAATCCTAAAGG - Intronic
1063002292 10:1935888-1935910 GCCTTCCTCCAAAATCCTAAAGG - Intergenic
1064186268 10:13164462-13164484 GCACTGCTCCAAGATCCTTGTGG + Intronic
1064517646 10:16168281-16168303 GTCTTGCTCTAAAATGCTAGAGG + Intergenic
1065005322 10:21374139-21374161 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1065109152 10:22423201-22423223 GCCCTTCTCCAGAATCCTAGGGG - Intronic
1065969811 10:30797384-30797406 GCCTTTCTCCAGAACCCTAGTGG - Intergenic
1066167031 10:32799255-32799277 GCCTTGCTCCAAAATCCGAGAGG + Intronic
1066666244 10:37785225-37785247 GTTTTGCTCCAGAATCCTAGAGG - Intronic
1066957616 10:42188028-42188050 GCCTTGCTGCAAAATACTAGGGG - Intergenic
1067333136 10:45340192-45340214 GCCTTGTTTCAAAATTTTAGAGG - Intergenic
1067754351 10:48993744-48993766 ATCTTGTTCCAAAATCCTAGAGG + Intergenic
1068137590 10:52965755-52965777 ACTTTGCTCCAAAATCAAAGTGG + Intergenic
1068837219 10:61568403-61568425 TCCTTGCTCCAAAATCCTAGTGG + Intergenic
1069192307 10:65506395-65506417 GCTTTGCTCCAAAATCCTAGAGG + Intergenic
1069209894 10:65742880-65742902 GCTTTGTTCCAAAATCCAAATGG + Intergenic
1069790835 10:71019608-71019630 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
1071267090 10:83974027-83974049 GCCTTGCTCCAAAATCCTAGTGG + Intergenic
1071364472 10:84884546-84884568 GCTTTGCTTCAAAATTCTAGAGG + Intergenic
1071378379 10:85033333-85033355 GCCTTGCTTCAAAATCCTAGAGG - Intergenic
1071673931 10:87637454-87637476 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
1071820052 10:89270837-89270859 GCTGTGCTCCAAGATCCTAAGGG - Intronic
1071937684 10:90549251-90549273 GCCTTGCTCCAAAATCCTGGAGG - Intergenic
1071942789 10:90607803-90607825 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
1071950804 10:90700962-90700984 ACCTTGCTCCAAAATCCTAAGGG + Intergenic
1072209261 10:93231703-93231725 GCCCTGCTCCAAAATCCTAGAGG + Intergenic
1072258160 10:93640809-93640831 AACTTGCTCCAGAAACCTAGTGG + Intronic
1072360466 10:94654118-94654140 ACCTTGCTCCAAAATCCTAGAGG - Intergenic
1073120506 10:101119766-101119788 TGCTTGCTCCAAAATCAGAGAGG + Intronic
1073557347 10:104465875-104465897 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1073656683 10:105424508-105424530 GCCTTGCTCAAAAATCCTAAAGG + Intergenic
1073670284 10:105579986-105580008 ACTTTGCTCCAAAATCTGAGCGG + Intergenic
1073703697 10:105958706-105958728 GCCTTGCTCCAGAAACCTTGTGG + Intergenic
1073830508 10:107378034-107378056 GCCTTGCTCTAATATCCTAAAGG + Intergenic
1073957688 10:108891678-108891700 GCCTTGTTCCAGAATCCTAGAGG + Intergenic
1073995877 10:109314742-109314764 GCCTTGCTCCAAAATCCCAGAGG + Intergenic
1074329525 10:112491147-112491169 GACTTACATCAAAATCCTAGAGG + Intronic
1074632517 10:115274076-115274098 GTTTTGCTACAAAATCCTAAGGG + Intronic
1075606785 10:123817374-123817396 GCCTTGCTCCAAAATCCTAGAGG - Intronic
1076113709 10:127880814-127880836 GAAGTGCTCCAAACTCCTAGCGG - Intronic
1076337750 10:129719923-129719945 TCTTTTCTCCAAAATCCCAGTGG + Intronic
1076772634 10:132674864-132674886 GCCTCACTCCAAAATCCTAGAGG + Intronic
1076927419 10:133499251-133499273 GCCTCGCTCCAAAATCCTAGAGG + Intergenic
1077389819 11:2295243-2295265 GCTTGACTCCAAAATCCTAAGGG + Intergenic
1077396472 11:2325959-2325981 GCCTTGCTCCAAAACTGTAAGGG - Intergenic
1077401197 11:2358443-2358465 ACCTTCCTCCAAAATCCTAAAGG - Intergenic
1077669457 11:4144545-4144567 GCTTCGGTCCAAAATCCTAAGGG - Intergenic
1080020143 11:27551691-27551713 GCTTTGCTCTAAAATCCTGAAGG + Intergenic
1080076588 11:28157470-28157492 GCCTTGCTCCAAAATCCTAGCGG - Intronic
1080196414 11:29614641-29614663 GACTTTCTCAAAAATACTAGAGG - Intergenic
1080825564 11:35846130-35846152 GCCTTGCTGAAGAACCCTAGAGG + Intergenic
1081065466 11:38534927-38534949 GTCTTGCTTCAAAATCCTAGAGG + Intergenic
1081072772 11:38631070-38631092 GCCTTGCTTCATAATCCTAGAGG - Intergenic
1081110473 11:39128368-39128390 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1081609057 11:44547827-44547849 GCCTTGCTCTAAAATCCTAGAGG - Intergenic
1082671696 11:56042991-56043013 GCCTTGCCCCAACATTCTAGAGG - Intergenic
1082999656 11:59279831-59279853 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1083093141 11:60221076-60221098 GCCTTCCTCCAAAATCCTAGAGG - Intronic
1083160272 11:60850144-60850166 GCCTCGGTCCAAATTCCCAGGGG - Intronic
1083718537 11:64592643-64592665 GTCTTGCTCTAAAACCCTAGAGG + Intronic
1084001984 11:66300889-66300911 GCCTGGCTCCCAAACCCCAGCGG + Intergenic
1084414478 11:69023362-69023384 TCTTTGCTCTAAAATCCCAGTGG + Intergenic
1085428527 11:76426270-76426292 GCCTCCCTCCAAGTTCCTAGTGG + Intergenic
1085685958 11:78622139-78622161 GACTTGCTCCAAAATCCTAGAGG - Intergenic
1085747566 11:79128189-79128211 GCTTTGCTCTAAAATCCTAGAGG - Intronic
1087002567 11:93435501-93435523 GCCTTGTTCCAGAATCTTAAGGG + Intronic
1087130547 11:94665955-94665977 TCCTTGCTCCAAAGTTCTATGGG - Intergenic
1087268066 11:96082681-96082703 GCCTTGCTCCATACTCCTTAGGG - Intronic
1088097199 11:106115104-106115126 GCCTTGCTCCAGAATCCTAGAGG - Intergenic
1088117689 11:106331477-106331499 GCTTTGCTACAAAATCTTAGCGG + Intergenic
1088191664 11:107234541-107234563 GCCTTGCTCTAAAATCCTAGAGG + Intergenic
1088265417 11:107983574-107983596 GCCTTGCTCTAAAATCCTAGAGG - Intergenic
1088305165 11:108399915-108399937 GCCTTCTTCCTAAACCCTAGAGG + Intronic
1088407615 11:109498710-109498732 GCTTTGCTCCAAAATCCTAGAGG + Intergenic
1088446440 11:109934309-109934331 GCCTTGGGCCAACATCATAGAGG - Intergenic
1088449350 11:109965317-109965339 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1088607657 11:111546858-111546880 GCCTTGCTTCAAAATCCTATGGG + Intronic
1088836651 11:113583338-113583360 GCCTTGCTCCAAAGTCCTAGAGG - Intergenic
1090197764 11:124831582-124831604 GCCTTGCCACAGAACCCTAGAGG - Intergenic
1090209497 11:124908098-124908120 GCCTTGCTTCAAAATCCTAGAGG + Intergenic
1090221619 11:125031636-125031658 GCCTTGCTCCAAAATCCTAGAGG + Intronic
1090430784 11:126644589-126644611 GCCTGGTACTAAAATCCTAGAGG + Intronic
1090738192 11:129630787-129630809 GGCTTACTCCAAATCCCTAGGGG + Intergenic
1091051735 11:132378705-132378727 ACTTTGCTCCAAAACCCTAGAGG - Intergenic
1092093279 12:5821600-5821622 GCCTTGCTCCAATATCCTAGAGG - Intronic
1092381556 12:8000888-8000910 GCCTTGCTTTAAAATCCTAAAGG - Intergenic
1092863368 12:12739020-12739042 TCCTTGCTCAAAAATCCTCAAGG - Intronic
1092922546 12:13245542-13245564 GCCTTGCTTCAAAATCCTAAGGG + Intergenic
1093031875 12:14296000-14296022 GCCCTGCTCCAAAATCCTAGAGG + Intergenic
1093036284 12:14335292-14335314 GCTTTGCTCAAAAATCCTAGAGG - Intergenic
1093048930 12:14485018-14485040 GCCTTGCTCCAAAATCCTGGAGG + Intronic
1093049676 12:14491013-14491035 GCTTTGCTCCAAAGTCCTGGAGG + Intronic
1093392089 12:18635585-18635607 CCTTTGCTCCAAAATCCTAAGGG + Intronic
1093645723 12:21583620-21583642 GCCTTGCTCCAAAATCCTAGAGG - Intronic
1093847496 12:23991000-23991022 TCCTTTATCCAAAATCCTAGAGG + Intergenic
1093964534 12:25310906-25310928 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1094102524 12:26779212-26779234 GCCTTGCTCCAAAATCCTAGAGG - Intronic
1094819393 12:34212676-34212698 GCCTTGCTCTGAAATCCTCAGGG - Intergenic
1095121511 12:38424894-38424916 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
1095442987 12:42256445-42256467 GATTTGCTCCAAAGCCCTAGAGG + Intronic
1095856246 12:46863725-46863747 GACTTGCTCAAAAATCCTGGAGG + Intergenic
1097076995 12:56402391-56402413 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1097564651 12:61252479-61252501 ACCTTGCTCCAAAATCCTAGAGG + Intergenic
1097821387 12:64132214-64132236 GCCTTGCTCCAAAATCCTAGAGG + Intronic
1097843364 12:64342808-64342830 GCCTTGCTCCAAAATCCTAGAGG + Intronic
1097890324 12:64771262-64771284 ACCTTGCCCCAAAACCCTATGGG - Intergenic
1098158364 12:67623573-67623595 ACCTTGCTCCAAAATCCTAAAGG - Intergenic
1098673035 12:73254194-73254216 GCCTTGCTCCAAAATCCTGGAGG - Intergenic
1098733286 12:74065581-74065603 GCCTTGCTTCAAAATCGTAGAGG - Intergenic
1098749841 12:74279541-74279563 GCCTTGCCCCAAAATCCTAGGGG - Intergenic
1098801473 12:74964799-74964821 ACTTTGCTCAAAAATCCTTGGGG - Intergenic
1098831911 12:75374075-75374097 GCTTTGCTCCAAAATCCTAGGGG + Intronic
1099183384 12:79492638-79492660 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
1099375644 12:81893907-81893929 CCCTTGCTCCAAAATCCTAGAGG - Intergenic
1099379386 12:81936590-81936612 GCTTTGCTCCAAAACCCTAGAGG + Intergenic
1099385529 12:82008404-82008426 GCCTTGCTCCAGAATTCCAGTGG - Intergenic
1099508559 12:83507135-83507157 ACCTTGCTCCAAAATCCAAGAGG - Intergenic
1099526358 12:83723061-83723083 GCCTTGCTTCATAATCCTAGAGG - Intergenic
1099557511 12:84128528-84128550 ACTTTGCTCCAAAATCGGAGTGG - Intergenic
1099578069 12:84405344-84405366 GACTTGCTCCAAAATTCTAGAGG - Intergenic
1099689010 12:85926765-85926787 GCCTTTCTCCAGAAACCTAGGGG - Intergenic
1099689776 12:85937987-85938009 GCCTTGCTCTAAAATCCTAGAGG - Intergenic
1099735782 12:86564989-86565011 ACCTTGTTCCAAAATCCCAGAGG - Intronic
1099804433 12:87499682-87499704 GCCTTGCTTCAAAATCCTGAAGG + Intergenic
1100083301 12:90878162-90878184 TGCTTGTTCCAAAATCCTAGAGG - Intergenic
1100241157 12:92711658-92711680 GTCTTGCTCCAAAATCCTAGAGG + Intergenic
1100480057 12:94969250-94969272 ACCTTGCTCCAAAGTCCTGTGGG + Intronic
1101190779 12:102330190-102330212 GCTTTATTCCAAAATCCTAAAGG - Intergenic
1101264127 12:103066072-103066094 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1101534672 12:105606154-105606176 GCCTTGCTCCAAAATCTTATAGG + Intergenic
1101543067 12:105682586-105682608 GCCTTGCTCCAAACTCCTATAGG - Intergenic
1101572402 12:105965972-105965994 GCCTTGCTCTAAAACCCTAAAGG + Intergenic
1102211239 12:111128734-111128756 GCCTTGCTCTAGAATCCTAAGGG + Intronic
1102716235 12:114975495-114975517 CCCAAGCTCCAAAATGCTAGAGG + Intergenic
1103396524 12:120611397-120611419 ACCTTGCTCCAAAATCCTAGAGG - Intergenic
1104288441 12:127446793-127446815 GACTTGCTCCAGAACCCCAGGGG - Intergenic
1104331776 12:127853548-127853570 CTCTATCTCCAAAATCCTAGAGG - Intergenic
1105333078 13:19436279-19436301 GCCTTTCTCCAAAATAATATAGG + Exonic
1105381219 13:19889219-19889241 ACCTTGCGCCAAAACCCTTGGGG + Intergenic
1105740104 13:23315126-23315148 GCCTTGCTCCAAAATCCTAGAGG - Intronic
1105878629 13:24583507-24583529 GCCTTTCTCCAAAATAATACAGG - Intergenic
1105921220 13:24965553-24965575 GCCTTTCTCCAAAATAATACAGG + Intergenic
1107505165 13:41026568-41026590 GTCTTGCTCCAAAATCCTACAGG - Intronic
1107782249 13:43916149-43916171 GACTTGCTCCAAGATCCTACGGG - Intergenic
1107983580 13:45756022-45756044 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
1108226161 13:48291939-48291961 GCCTTGCTCCAGAACCTCAGGGG + Intergenic
1108302441 13:49092035-49092057 GCCTTGCCCCAAAATCCTAGAGG + Intronic
1108856814 13:54802835-54802857 GCCTTATTCCAAAGCCCTAGGGG - Intergenic
1108904273 13:55449921-55449943 GCCTTTCTCCAAAATCCTAGAGG - Intergenic
1108914308 13:55588921-55588943 GCTTTGCTACAAAATCCTGGAGG + Intergenic
1109293218 13:60500068-60500090 GCCTTGCTCCAAAATCCTAGAGG - Intronic
1109359424 13:61276419-61276441 GCTTTGCTCTAAAATCATAATGG - Intergenic
1109519018 13:63484751-63484773 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1109583044 13:64366089-64366111 GCCTTGCTCCAAAATCCTTGAGG - Intergenic
1109712685 13:66180872-66180894 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
1109933296 13:69245225-69245247 GCCTTGATCCCAAAACCTAAAGG + Intergenic
1109951028 13:69502255-69502277 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
1110377168 13:74806424-74806446 GCCTTGCTCCAAAATCTTTGAGG - Intergenic
1110544308 13:76739087-76739109 ACTTTGCTTCAAAATCATAGTGG + Intergenic
1110834140 13:80064679-80064701 GTCTTGTTCCAAAATCCTAGAGG + Intergenic
1111057806 13:82973078-82973100 ATCTTGCTCCAAAATCCTAGAGG + Intergenic
1111243665 13:85507982-85508004 ACTTTGCTCCAAAATCAGAGTGG - Intergenic
1111317496 13:86581753-86581775 GCCTTGCTCCAATATTCTGGAGG - Intergenic
1111595306 13:90403717-90403739 ACTTTGCTCCAAAATCAGAGTGG - Intergenic
1112231132 13:97590214-97590236 GGCTTGCTCCAAAATCCTTGAGG + Intergenic
1112249933 13:97770328-97770350 GCCTTGCGCCAAAATCCTAGAGG + Intergenic
1113319710 13:109221713-109221735 GCCTTGCCCCAAAATCCTAGAGG + Intergenic
1114150429 14:20032179-20032201 GACTTGCTTAGAAATCCTAGGGG - Intergenic
1114205866 14:20570719-20570741 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1114758262 14:25283928-25283950 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
1114905380 14:27120472-27120494 GCCTTGCTGCAAAATCCTAGAGG + Intergenic
1114965617 14:27955702-27955724 TTTTTGCTCCAAAATCCTAAGGG + Intergenic
1115023158 14:28707741-28707763 GCCTTGCACCAGAATTGTAGGGG - Intergenic
1115130690 14:30049210-30049232 GCCTTGCTCCAAAATCCTAGAGG - Intronic
1115143393 14:30199337-30199359 GCCTTGCTGCAAAATCCTAGAGG - Intergenic
1116058903 14:39896888-39896910 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1116068089 14:40009121-40009143 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1116158383 14:41236715-41236737 ACCTTGTTCCAAAATCTTAGAGG + Intergenic
1116308052 14:43283497-43283519 GCATTGCTCCAAAATCCTAGGGG + Intergenic
1116415067 14:44669262-44669284 GACTTGCTCCAAATTCCTAGAGG - Intergenic
1117001594 14:51376262-51376284 GCCTGGCTCCAAAATCCTAGAGG - Intergenic
1117216838 14:53560125-53560147 GCCTTACTCCAAACTCCTAGAGG - Intergenic
1117294641 14:54367705-54367727 GCCTTGCTCTTATATCTTAGAGG + Intergenic
1117596278 14:57329932-57329954 ACTTTGCTCCAAAATCCTAGAGG + Intergenic
1117634128 14:57724323-57724345 GCCTTGCTCCAAAATCCTAGAGG - Intronic
1118122438 14:62860220-62860242 GCCTTGCTCCAAAATCCTAGAGG + Intronic
1118385506 14:65252593-65252615 AACTTGCTCCAAAATCCTGAAGG + Intergenic
1118501830 14:66369341-66369363 GCCTTACTCCAAAATCGTGAAGG - Intergenic
1119059701 14:71462240-71462262 GCCTTGCTCCAAAATCCTAGAGG + Intronic
1120082029 14:80227580-80227602 GCCATGCTCCAAAATCCTACAGG + Intronic
1120250745 14:82059699-82059721 GCCTTTCTCCAAACTCCTAAAGG + Intergenic
1120555999 14:85930495-85930517 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
1122639087 14:103146755-103146777 GAATTGCTCCACAATTCTAGAGG + Intergenic
1202935481 14_KI270725v1_random:83738-83760 GCCTTGCTGCAAAATACTAGAGG + Intergenic
1123817820 15:23997552-23997574 GCCTTGCTGCAAAATCTGAAGGG + Intergenic
1123908505 15:24943704-24943726 GCTTTGCTCCAATATCCTAAAGG + Intronic
1124703343 15:31936765-31936787 GTCTTTGTCCAAAATCCTAACGG - Intergenic
1125031608 15:35081209-35081231 GCCTTTCTCCAAAATAATACAGG - Intergenic
1125861993 15:43008328-43008350 GCTTTGCTCCAAAATCGGAGCGG - Intronic
1127356909 15:58209139-58209161 GCCTTGCTCCAAAATCCTAGAGG - Intronic
1128051583 15:64669615-64669637 GCCTTACTCCAAAATTCAAAAGG - Intronic
1129183481 15:73891674-73891696 GCTTTGCTCCGAAATCAGAGTGG - Intergenic
1129906677 15:79192501-79192523 GCCTGCCTCCAAAAGCCAAGAGG + Intergenic
1131126058 15:89858055-89858077 GCATTACTCCAAAATCCCAATGG - Intronic
1131724005 15:95202746-95202768 GGCCTGCTCCAAAATCCTAGAGG - Intergenic
1134078483 16:11308766-11308788 GCTTTGCTCCAAGATCAGAGTGG + Intronic
1135688071 16:24514313-24514335 GCCTTGCTCCAGAACCCTATGGG - Intergenic
1136250936 16:29004541-29004563 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1137334402 16:47533639-47533661 ACTTTGCTCCAAGATCATAGTGG + Intronic
1137588552 16:49679464-49679486 ACTTTGCTCCAAAATCAGAGAGG - Intronic
1138041675 16:53677753-53677775 GCCTTGCTCCACAAGCACAGAGG - Intronic
1138868380 16:60850735-60850757 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1139134618 16:64187005-64187027 GCCTTGCTCCAAAATACTAAAGG - Intergenic
1140485962 16:75293523-75293545 GCCTTGCCCCGAAGACCTAGAGG - Intergenic
1141559548 16:84858088-84858110 GCCTTACTCCAAAATCCTAGAGG + Intronic
1142588387 17:988631-988653 GCTTTGCTCCAAAATCCTACAGG + Intergenic
1143050120 17:4118400-4118422 GCCTTGCTCCAAAATCTTAAAGG + Intronic
1145984502 17:29036175-29036197 GGCCTTCTCCAAAAGCCTAGGGG + Intronic
1146237979 17:31185898-31185920 GCCTTGCTCCAAAATCCTAGAGG - Intronic
1146836349 17:36113950-36113972 GACTTGCTCCAAAATCCTGGAGG - Intergenic
1146838500 17:36132593-36132615 AACTTGCTCCAAAACCCTAGGGG - Intergenic
1149065547 17:52475109-52475131 GCCTTGTTGCAAATTCATAGAGG - Intergenic
1150201600 17:63362711-63362733 GCTTTGCTCCGAAATCAGAGTGG + Intronic
1151509618 17:74550224-74550246 GCCCTGCTCCCAAATCCTGCAGG + Intergenic
1153089702 18:1330108-1330130 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1153131280 18:1857763-1857785 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
1153217698 18:2835656-2835678 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
1154068459 18:11131045-11131067 GCCTTGCTCCAAAATCCTAGAGG - Intronic
1154252677 18:12757329-12757351 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
1154506167 18:15042836-15042858 GCCTTGCTAGAAAATCCTAGAGG - Intergenic
1155234308 18:23804188-23804210 ACTTTGCTCCAAAATCCTAAGGG + Intronic
1155830923 18:30514006-30514028 GCTTTGCTCCAAGATTGTAGTGG + Intergenic
1155940702 18:31799544-31799566 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1156582548 18:38394410-38394432 ACCTTGCTCCAAAATCCTAGAGG - Intergenic
1156606366 18:38671711-38671733 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1156990309 18:43400829-43400851 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
1157165364 18:45353845-45353867 GCTTTACTCTAAAATCTTAGAGG + Intronic
1157506593 18:48230889-48230911 ACTTTGCTCCAAAATCAGAGTGG - Intronic
1157870937 18:51229635-51229657 GCTGTGCTTCAAAATCCTAGAGG + Intergenic
1157998508 18:52588178-52588200 TCCTTGCTTCAAAATCCTAGAGG + Intronic
1159152211 18:64535091-64535113 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
1159265849 18:66077540-66077562 GACTTACTCCAAAATTCAAGAGG + Intergenic
1159269297 18:66128230-66128252 ACTTTTCTCCAAAATCCTAAAGG - Intergenic
1159287785 18:66375428-66375450 GCCTAGCTCCAAAATCCTAGAGG - Intergenic
1159559110 18:69975405-69975427 GCCTTGCTCCAAAGTCCTAGAGG + Intergenic
1159711299 18:71764070-71764092 GTCTTGCTCCAAAATCCTAGAGG - Intronic
1159878160 18:73833099-73833121 GACTTGCTCCAGAATTCTAGGGG + Intergenic
1160092460 18:75839961-75839983 GCCGTGCTCCAAAATCCTAGAGG - Intergenic
1164097091 19:22021397-22021419 GCTTTGTTACAAAATCCTACAGG + Intergenic
1164117263 19:22234628-22234650 GCTTTGCTCCAAAATCCTAGAGG + Intergenic
1164763858 19:30748010-30748032 GCCTTGATCCAAAACCCTAGGGG + Intergenic
1165560093 19:36671662-36671684 GCTTTGCTCCAAAATCCTCAGGG - Intergenic
1167951574 19:53031872-53031894 CCCTTGCTCCAAAATCCCAGAGG - Intergenic
1168260114 19:55188663-55188685 ACCTTTCTCCAAAATCGTCGTGG + Intronic
1168539341 19:57197424-57197446 GCCTTGCTCCAAAATCCTAGAGG + Intronic
925499412 2:4486975-4486997 GCTTTGCTCCAAAATCCTAGAGG + Intergenic
926810402 2:16750729-16750751 GTCTTGCTTCAAAATCCTGGAGG + Intergenic
926825571 2:16902284-16902306 GACTTGTTCCAAAATCCTACAGG + Intergenic
926826757 2:16913615-16913637 GTCTTGCTCCAAAATCCTAGAGG - Intergenic
927008712 2:18879670-18879692 GCTTTGCTCCAAAATCCTAGAGG - Intergenic
927660428 2:24988615-24988637 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
929269831 2:39960832-39960854 GCCTTGCTCCAAAATCCTGGAGG + Intergenic
929552251 2:42901954-42901976 GACTTGCTCAAAAATACTTGAGG - Intergenic
930295410 2:49547563-49547585 GTCTTGCTCCAAAATCCTAGAGG + Intergenic
930418597 2:51120941-51120963 GCCTTTCTCCAAAATCGTAAAGG - Intergenic
930536611 2:52652315-52652337 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
930910145 2:56620845-56620867 GTCTTGCTCCAAAATCCTAGTGG - Intergenic
931393766 2:61867447-61867469 TCCTTTCTCCACAATGCTAGAGG + Intergenic
932633280 2:73365348-73365370 ATTTTGCTCCAAAATCCTAAGGG - Intergenic
932870710 2:75395135-75395157 TAGTTGCTCCAAAATCCTAGAGG + Intergenic
933265689 2:80178435-80178457 GCCTTGTTCCAAAATCCTAGAGG + Intronic
933394466 2:81713409-81713431 ACCTTGCTTCAAAATCCTAGAGG + Intergenic
934305736 2:91820542-91820564 GCCTTGCTGCAAAATACTAGAGG - Intergenic
934327520 2:92032200-92032222 GCCTTGCTGCAAAATACTAGAGG + Intergenic
934465909 2:94262779-94262801 GCCTTGCTGCAAAATACTAGAGG + Intergenic
935183930 2:100714847-100714869 GCCTTGCTCCAAAATCCTACAGG - Intergenic
935425115 2:102911379-102911401 GCCTTGCTCCAAAATTCTAGAGG + Intergenic
935564314 2:104590305-104590327 GCCTTTCTCCAAAATCCTAGAGG + Intergenic
935875809 2:107505724-107505746 GTCTTCCTCCCAATTCCTAGAGG - Intergenic
936175965 2:110220124-110220146 GCCTTGTTTCAAACTCCTGGAGG - Intergenic
936646297 2:114376434-114376456 GCCTTGCTCCAAAGTTCTAAGGG + Intergenic
937582068 2:123499219-123499241 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
937737785 2:125313027-125313049 ACATTGCTCCAAAATCACAGTGG - Intergenic
937785211 2:125887780-125887802 ACCTCGCTCTAAAATCCTAGAGG + Intergenic
937800322 2:126074676-126074698 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
937852575 2:126648790-126648812 GCCTTGATCCAAAATCCTAGAGG + Intergenic
939069056 2:137517804-137517826 GCCTTGCTCCAATATCCTAGAGG - Intronic
939213867 2:139212188-139212210 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
939788691 2:146546165-146546187 GACTTGCTTCACAATCCTAGAGG + Intergenic
939806235 2:146778422-146778444 GCCTTGCTCCAAAATTCTAGAGG - Intergenic
940171317 2:150832764-150832786 GCCATCCTCCAAAATCCTAGAGG + Intergenic
940371208 2:152902938-152902960 GCCTTTCTCCAATATCCTTGGGG + Intergenic
940472093 2:154113179-154113201 GCCTTGCTCTAAAATCCTAGAGG + Intronic
940605920 2:155924340-155924362 GTCTTGCTCCCAAATCCTAGAGG + Intergenic
941330673 2:164174617-164174639 GCCTTGTTCCAAAACCCTAGAGG + Intergenic
941668012 2:168261078-168261100 GCCTTGCTCTAAAATCCTAGAGG - Intergenic
942081794 2:172406831-172406853 GGTTTTCTCCAAAATCCTATTGG - Intergenic
942321940 2:174743494-174743516 GCCTTGCTCCAAAATCCTAAGGG - Intergenic
943006891 2:182395789-182395811 GCCTTGCTCCCAAATCCTAGAGG - Intronic
943239224 2:185362624-185362646 GCCTTGTTCCAAAATCCTAGAGG + Intergenic
943384068 2:187181142-187181164 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
943385888 2:187203325-187203347 ACCTTGCTCCAAAATCCTAGAGG + Intergenic
943820445 2:192314861-192314883 GCCCTGCTCCAAGATCAGAGCGG + Intergenic
943950555 2:194129047-194129069 ACTTTGCTCCAAAATCGGAGTGG + Intergenic
944997853 2:205314703-205314725 GACTGTCTCCAAAATCCTGGTGG - Intronic
945642173 2:212443785-212443807 GCCTTGCTCCAAAATTCTAGAGG - Intronic
945717840 2:213380721-213380743 GCCTTGCTCCATAATCCAAGAGG + Intronic
945725850 2:213471546-213471568 GGCCTGCTCCAAAATTTTAGAGG + Intronic
946790916 2:223299708-223299730 GCCTTGATCCAAATCCCTAGAGG - Intergenic
947440720 2:230118718-230118740 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
947440841 2:230120205-230120227 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1169311307 20:4542711-4542733 GCCTTGATCCAAAATCCTATGGG + Intergenic
1171330079 20:24329723-24329745 GCTTTCATCCAAAATCCTAAGGG + Intergenic
1174166173 20:48585011-48585033 GCCTTGTTCTAAATTCCAAGAGG + Intergenic
1174363177 20:50041007-50041029 GCCTGGCTCCAAGACCCCAGGGG + Intergenic
1175342448 20:58242247-58242269 GCTTGACTCCAAGATCCTAGTGG - Intergenic
1175489397 20:59369272-59369294 GCCTTGCTCCAGCACCCAAGTGG + Intergenic
1176078607 20:63260536-63260558 GCCCTGCTCCAAAAGCAGAGAGG - Intronic
1176130383 20:63494371-63494393 ACCCTGCTCCAAGATCCCAGGGG + Intronic
1176596905 21:8705974-8705996 GCCTTGCTGCAAAATATTAGAGG + Intergenic
1176739957 21:10592298-10592320 GCCTTTCTCCAAAATAATACAGG - Exonic
1176791686 21:13326188-13326210 GCCTTGCTAGAAAATCCTAGAGG + Intergenic
1176870519 21:14080106-14080128 GCCTTGCTCCGAAATCCTCAAGG - Intergenic
1177139423 21:17342321-17342343 GCCTTGATCCTAAATCCTAGAGG + Intergenic
1177192846 21:17870967-17870989 GCTGTGCTCCAAAATCCTAAAGG + Intergenic
1177505566 21:22014233-22014255 GGCTTGCTCCAAAATCCTTGAGG + Intergenic
1177523784 21:22266584-22266606 TCCTTGCTCCAAATTCCTGATGG - Intergenic
1177875473 21:26626288-26626310 ACTTTGCTCCAAAATCGGAGTGG + Intergenic
1177913170 21:27056158-27056180 GACTTGCCCCAAAATCCTTGAGG - Intergenic
1177933702 21:27316985-27317007 GTCTTGCTCCAAAATCCTAGAGG + Intergenic
1177991076 21:28037190-28037212 GCCTTGCTAGAAAATTCTAGAGG + Intergenic
1178012654 21:28305123-28305145 GCCTTGCTCCAAAATCCTGGAGG - Intergenic
1179289754 21:40008133-40008155 TCCTTGCTCCAAGATCCTTGGGG - Intergenic
1179383522 21:40921000-40921022 GCCTTCCTCCAAAATCCGAGAGG - Intergenic
1179415155 21:41192573-41192595 GCCTTGCTCCAATATTCTAGAGG + Intronic
1180279828 22:10683416-10683438 GCCTTGCTGCAAAATACTAGAGG + Intergenic
1180587044 22:16901952-16901974 GCCTTGCTGCAAAATACTAGAGG + Intergenic
1180591152 22:16938419-16938441 GTCTTGCTCCAAAATCCTAGAGG + Intergenic
1181367442 22:22388996-22389018 GCCTTGCACCAAAATCCTAGAGG + Intergenic
1181420647 22:22795779-22795801 GCCTTGCTCCAAAATCCTGGAGG - Intronic
1181443515 22:22951099-22951121 GACTTGCTCCCACGTCCTAGAGG - Intergenic
1182372179 22:29819043-29819065 GCCTTGCTCCAAGCTCCTGGAGG + Intronic
1183760428 22:39811473-39811495 ACCTTACTCCAAAGCCCTAGTGG - Intronic
1184193948 22:42914136-42914158 GCTCTGCTCCATAATCATAGGGG + Intronic
949125669 3:443198-443220 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
949170042 3:986650-986672 GCCTTGCTCTAAAATTCTAGAGG + Intergenic
949245861 3:1924870-1924892 GCCTTGTTCTAAAATCCTAGAGG - Intergenic
949417597 3:3830935-3830957 GCCTTGCTCCAAAATCCTAGAGG + Intronic
949445606 3:4131001-4131023 GCCTTGCTCCAAAATCCTACAGG - Intronic
949638775 3:6012464-6012486 GCCTTGCTTCAAAATCCTAGAGG - Intergenic
950820971 3:15758168-15758190 TCCTTGCTCCTAAATCACAGAGG + Intronic
951003614 3:17592799-17592821 GCCTTGCTCCAAAATCCTAGAGG - Intronic
951122565 3:18945514-18945536 GCCTTGCTCCAAAATCTGAGAGG - Intergenic
951291524 3:20876798-20876820 GCCTTGGTCCAAAATCCTAGAGG + Intergenic
951384521 3:22027482-22027504 ACCTTGCTCCAAAATCCTAGAGG - Intronic
951736270 3:25868509-25868531 GCCTAGCTCCAAGATGCTAGTGG - Intronic
951970769 3:28441918-28441940 GCCTTGCTCCAAAATCCTGGAGG + Intronic
951978814 3:28543585-28543607 ACTTTGCTCCAAAATCCTAAAGG - Intergenic
952605449 3:35142067-35142089 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
952793266 3:37217306-37217328 ACCTTGCTCCAAGATCGGAGTGG - Intergenic
954511495 3:51129714-51129736 GCCGTGCTCCAGAATCCCAAAGG + Intronic
954831646 3:53426135-53426157 GCCTTGCTCCAGAATCCCAGGGG + Intergenic
955035579 3:55264039-55264061 GCCTTGCTCCAAAATCCTAGTGG - Intergenic
955418758 3:58716615-58716637 GCCTTGCTCCAAAACCCTAAAGG + Intergenic
955994542 3:64666520-64666542 GCCTGGCTCCAGAATCCAAGTGG - Intronic
956306870 3:67835569-67835591 GCCTTGCTCGAAAATCCTAGAGG - Intergenic
956360447 3:68441385-68441407 GCTTTGCTCTAAAATCTTAGAGG - Intronic
956462207 3:69484095-69484117 GCCTTGCTCAAAAAGCTTTGAGG - Intronic
956509656 3:69980319-69980341 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
957136351 3:76294118-76294140 ACTTTGCTCCAAAATCAGAGTGG + Intronic
957247588 3:77733950-77733972 GCCGTGCTCCAAAATCCTAGGGG + Intergenic
957744304 3:84318580-84318602 GCTTTGCACCAAAATCCTAAGGG + Intergenic
957874583 3:86129271-86129293 GTATTAATCCAAAATCCTAGGGG - Intergenic
958487683 3:94732527-94732549 GACTTGCTCCAAAATCCTAGAGG + Intergenic
958692081 3:97481416-97481438 GCCTTTCTCCAAAATAATACAGG + Intronic
958803410 3:98781875-98781897 GCCTTGCTTAACATTCCTAGTGG + Intronic
958934299 3:100240575-100240597 GTCTTGCTCCAAAATCCTAGAGG - Intergenic
959100176 3:102001155-102001177 TCTTTGCTCCAAAATCCTAAGGG + Intergenic
959226782 3:103597329-103597351 ACCTTGCTCCAAAATCCTAGAGG + Intergenic
959377350 3:105602887-105602909 GCCTTGCTCCAAAATACTAGAGG + Intergenic
959417101 3:106088670-106088692 GACAGGCTCTAAAATCCTAGAGG + Intergenic
959439504 3:106359129-106359151 GCTTTGCTCTAAAATCCTAGAGG - Intergenic
960136930 3:114115004-114115026 GTCTTGCTTCTGAATCCTAGGGG - Intergenic
960494751 3:118360833-118360855 GCCTTGCTCCAAAATCCTAAAGG + Intergenic
961262842 3:125616370-125616392 GCCTTGCTCCAAAGTCCTGGAGG - Intergenic
961540230 3:127594433-127594455 GTCTTGCTCCAGAACCCTAGGGG - Intronic
961607456 3:128107232-128107254 TACTTGCTTCCAAATCCTAGGGG + Intronic
961710982 3:128828055-128828077 GCCTTGCTCCAAAATCCCAGAGG + Intergenic
961858854 3:129897932-129897954 GCTTTGCTCCAAAATCTTAAGGG + Intergenic
962212024 3:133487229-133487251 ACTTTGCTCCACAATCATAGTGG + Intergenic
963020840 3:140871701-140871723 GCCTTGCTTCAGAACCTTAGGGG - Intergenic
963331820 3:143923426-143923448 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
963355667 3:144206913-144206935 GCTTTGCTCCAAAATCCTAGAGG + Intergenic
963453665 3:145516614-145516636 ACTTTGCTCCAAAACCCTAAAGG - Intergenic
963548685 3:146694389-146694411 GCCTTCCTTCAAAATCCTGAAGG + Intergenic
964297667 3:155251868-155251890 GCCTTGTTCCAAAAACCTGAAGG - Intergenic
964505909 3:157398675-157398697 GCCTTGCTCTAGAATCCTAAAGG + Intronic
964669242 3:159207295-159207317 TTCTTGCTTCAAAACCCTAGTGG + Intronic
964679251 3:159318967-159318989 GCCTTGCTCCAAAATCCTAGAGG + Intronic
964977216 3:162635840-162635862 GCCTTGCTCCAAAATCCTAGTGG + Intergenic
965118697 3:164522485-164522507 ACTTTGCTCCAAAATCAGAGTGG + Intergenic
965207789 3:165744092-165744114 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
965226771 3:166000817-166000839 ACCTTGCTCCAAAATCCTAGAGG + Intergenic
965259767 3:166467239-166467261 GCCTTGTTCCAGAATCCTAAAGG - Intergenic
965291746 3:166889633-166889655 GCCTTGCTCTAAAATCCTTGAGG + Intergenic
965708651 3:171534832-171534854 GCCTTGCTGCAATATCTTAAGGG + Intergenic
966044335 3:175530974-175530996 GCCTTACTCCAAAATCCTAGAGG + Intronic
966445688 3:179998506-179998528 GCCTTGCTCCAAAATCCTAGAGG - Intronic
967440028 3:189496414-189496436 GCCTTGTTCTACTATCCTAGGGG + Intergenic
967831770 3:193925942-193925964 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
968906940 4:3457914-3457936 GCCTTGCCCCAAAATCTGAGAGG - Intergenic
969548898 4:7851105-7851127 GCCGTGCTCCAAACTCCCAGAGG - Intronic
970816399 4:20161251-20161273 GTCCTGCTCCAAAATCCCAAAGG - Intergenic
971460542 4:26890874-26890896 GCTTTGCTCTAAGATCCTAAGGG + Intronic
971475517 4:27068279-27068301 GCCTTGCTCAAAGATCTCAGCGG - Intergenic
971817224 4:31505022-31505044 GCCTTGCTCCAAAATCCTACAGG - Intergenic
971857655 4:32062886-32062908 TCCTTGCTCCAAAATCCTAGAGG + Intergenic
971979301 4:33732926-33732948 GCCTTGCTTCAAAATCCTAGAGG + Intergenic
972085220 4:35207061-35207083 GCCTTGCTCCAAAATTTTAGAGG - Intergenic
972106395 4:35494130-35494152 ACTTTGCTCCAAAATCAAAGTGG - Intergenic
972201305 4:36717206-36717228 GTGTTGCTCCAAAATCCTAGGGG + Intergenic
972882967 4:43448207-43448229 GCCTTGCTCCAAAATCCCAGAGG + Intergenic
973098045 4:46226710-46226732 GCCTTGCTCCAAAATCCTAAGGG - Intergenic
973118434 4:46488990-46489012 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
973120985 4:46520951-46520973 GCCTTGCTCCAAAATTCTAAAGG + Intergenic
973130195 4:46639748-46639770 GCCTTACTCAAAAATCCTAGAGG + Intergenic
974243594 4:59284119-59284141 GTTTTGCTCCAAAATCCTAAGGG + Intergenic
974262375 4:59542322-59542344 ACCTTGCTCCAAAATCCTAGAGG + Intergenic
974289563 4:59912689-59912711 GCCTTGCTCCAAAATTCTAGAGG - Intergenic
974510370 4:62832891-62832913 GCTTTGCTCCAAAATCCTAAGGG + Intergenic
974564784 4:63568260-63568282 TTCTTGCTCCAAAATCCTAGAGG - Intergenic
974644621 4:64674817-64674839 GCCTTGCTTCAAAATCCTAAAGG + Intergenic
974697870 4:65398205-65398227 ACTTTGCTCCAAAATCAGAGTGG - Intronic
974727209 4:65812471-65812493 TCCTTCCTCCAAAATCCTAGAGG - Intergenic
974746921 4:66088958-66088980 GCCTAGCTCCAAAATCCTAGGGG + Intergenic
975742128 4:77439657-77439679 GCCATGCTCTAAAAGCCTAAGGG - Intergenic
975798546 4:78034768-78034790 GCCTAGCTCCAGAACCCTAAAGG - Intergenic
976034210 4:80795874-80795896 GACTTGCTCCAAAATTCTAGAGG + Intronic
977031617 4:91891354-91891376 GCCTCGCTCAAAAATCCTAGAGG - Intergenic
977204712 4:94155631-94155653 GCCTTGCTCCAACATCCTAGAGG - Intergenic
977430761 4:96928159-96928181 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
977490079 4:97700121-97700143 GCCTTGCTTCAAAATCCTAGAGG + Intronic
977833278 4:101618221-101618243 GCTTTGCTCCAAAATCCTAGAGG + Intronic
978267495 4:106843868-106843890 GCTTTACTCCAAAATCACAGTGG + Intergenic
978341595 4:107725602-107725624 GCTTTGCTCCACAATCCTAGAGG + Intergenic
978772157 4:112467833-112467855 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
978899082 4:113926871-113926893 GTCCTGCTCCAAAATCCTAGAGG + Intronic
978918649 4:114154486-114154508 TCTTTGCTCCAAAATCCTAAGGG - Intergenic
978966846 4:114750891-114750913 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
978986091 4:115014737-115014759 GCATTGCTCCAAAATTCTAAGGG - Intronic
979048204 4:115896489-115896511 GCTTTGCTCAAAAATCTTAAGGG - Intergenic
979595737 4:122532238-122532260 GCTTTGCTACAAAATCCTAAAGG + Intergenic
979684387 4:123495551-123495573 TCTTTGCTTCAGAATCCTAGAGG - Intergenic
979767015 4:124474542-124474564 GTCTTGCTCCAAAATCCTACAGG - Intergenic
979888571 4:126062226-126062248 GCCTTGATTCAAAATCCTAAAGG + Intergenic
979898404 4:126189110-126189132 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
980306359 4:131065452-131065474 ACCTTGCTCCAAGATCAGAGAGG + Intergenic
980385792 4:132087084-132087106 GCCTTGTTCCAAAATCCTAGAGG + Intergenic
980387952 4:132111234-132111256 GACTTTCTCAAAAATCCTAGAGG + Intergenic
980497531 4:133605415-133605437 GCCTTGCTCCAAAATCCTGGAGG + Intergenic
980602155 4:135039467-135039489 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
980629518 4:135414233-135414255 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
980957727 4:139445864-139445886 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
981062113 4:140436087-140436109 CTCTTACTGCAAAATCCTAGTGG - Intergenic
981834998 4:149043892-149043914 GCCTTGCTCCAAAGTCCTAGAGG - Intergenic
981857362 4:149310371-149310393 GTCTTGCTCCAGAAATCTAGGGG - Intergenic
981979363 4:150772657-150772679 GCCTTGCTCCAAAATCCTATGGG + Intronic
982181036 4:152748639-152748661 ACTTTGCTCCAAAATCAGAGCGG - Intronic
982354481 4:154451245-154451267 GCTTTGCTCTAAAATCCTAAGGG - Intronic
982835533 4:160116589-160116611 GCCTTGCTACAAAATCTTAGAGG - Intergenic
982847763 4:160274243-160274265 CCCTTGCTCCAAAATCCTAGGGG - Intergenic
983027385 4:162755242-162755264 GACTTGTTCCAAAATCCTAGAGG - Intergenic
983339031 4:166434416-166434438 GCTTTGCTTCAAAATCCTAAAGG - Intergenic
983582672 4:169324759-169324781 TCCTTGCTCCAAAATCCTAGAGG - Intergenic
983676141 4:170295621-170295643 GCCTTGCTCCAGAACCTTAAGGG - Intergenic
984060291 4:174982077-174982099 GCCTTGTTCCAAAATCCTAGGGG + Intergenic
984948081 4:184985456-184985478 GACTTAGTCCAAAATTCTAGAGG - Intergenic
986037036 5:3950485-3950507 GCCTTGTTCCCAAATCCTAGAGG + Intergenic
986087105 5:4462665-4462687 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
986742914 5:10719453-10719475 GCCTTGCTCCAAAATCCTAGTGG - Intronic
986959834 5:13199166-13199188 GCTCTGCTCCAATATCCTAGAGG - Intergenic
987033857 5:14000303-14000325 GCCTTGCTCCCAGCTCCTGGCGG - Intergenic
987108049 5:14660325-14660347 GATTTGCTTCAAAATCCTAAGGG + Intergenic
987142436 5:14959973-14959995 GCCTTCCTCCAAAATGGGAGAGG - Intergenic
987153169 5:15061613-15061635 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
987280110 5:16405097-16405119 CCTTTGCTCCAAAATCCTATTGG + Intergenic
987468193 5:18297037-18297059 ACCTTACTTCATAATCCTAGAGG + Intergenic
987504383 5:18749801-18749823 GCTTTGCTCAAAAATTCTAGAGG - Intergenic
987578347 5:19758364-19758386 GCATTGCTCCAAAATCATAGAGG + Intronic
987657143 5:20821704-20821726 GACTTGCTCCAAAATCCTAGAGG + Intergenic
987885438 5:23806447-23806469 GCCTTGTTCCAAAATCCTAGAGG - Intergenic
988056574 5:26105320-26105342 GCATTGCTCCAAAACCCTGGAGG + Intergenic
988107754 5:26772494-26772516 ACCTTGCTCCAAAATCCTAGAGG - Intergenic
988160828 5:27516923-27516945 GCCTTGCTCCAAAATCTTAGAGG + Intergenic
988169207 5:27632890-27632912 GTCTTGCTCCTAAATCCTAGAGG + Intergenic
988228764 5:28448074-28448096 GCCTTGCTCCCAAATCCTAGAGG - Intergenic
988233293 5:28507141-28507163 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
988258171 5:28848488-28848510 GCCTTTCTCCAAAATCTCAAAGG - Intergenic
988562124 5:32290795-32290817 GCCTTGCTCCAAAATCCTGGAGG - Intronic
988766408 5:34382244-34382266 GACTTGCTCCAAAATCCTAGAGG - Intergenic
989045212 5:37267643-37267665 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
989307508 5:39974673-39974695 GCCTTGCTCCAAAATTCTAGAGG + Intergenic
989457649 5:41661820-41661842 GCCTCGTTTCAAAATCCTAGAGG + Intergenic
989486389 5:41996411-41996433 GCCTTGCTTCAAAATCCTAGAGG + Intergenic
989550335 5:42727445-42727467 GGTTTGCTCCAAAACTCTAGGGG + Intergenic
989730533 5:44642172-44642194 ACTTTGCTCCAAAATCAAAGTGG + Intergenic
990938344 5:61174280-61174302 ACCTTGCTCCAGAATCCCAGGGG - Intergenic
991013811 5:61910952-61910974 GCCTTGCCCCAAAATCTTAGAGG + Intergenic
991234162 5:64375111-64375133 GCTTTGCACCAAAATCCTAAAGG - Intergenic
991256335 5:64618976-64618998 GCCTCGCTTCAAAACCCTAAGGG + Intergenic
991330741 5:65489733-65489755 TCCTTGCTCCAAAATCCTAGAGG + Intergenic
991946141 5:71900088-71900110 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
992109886 5:73482929-73482951 GCTTTGCTTCAAAATCCAAAGGG + Intergenic
992242934 5:74789699-74789721 GCCTTGCTCCAAAATCCTAGAGG - Intronic
992242950 5:74789815-74789837 GCCTTGCTCCAAAATCTTAGAGG - Intronic
992344698 5:75865034-75865056 GCCTTGCTCCAGAACCCCAGGGG - Intergenic
993203389 5:84847488-84847510 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
993231905 5:85247585-85247607 AACTTTCTCCAAAATCCTAGAGG + Intergenic
993319823 5:86458526-86458548 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
993363163 5:87002857-87002879 GCCTTGCTCCTGAACCCTGGGGG + Intergenic
993367473 5:87051008-87051030 GCCTTGCTCCAAAATTTTAGAGG + Intergenic
993412586 5:87591864-87591886 ACCTTGCTCCAAAATCCTAGAGG + Intergenic
993551677 5:89281070-89281092 GACTTCTTCCAAAATCATAGTGG + Intergenic
993567394 5:89491856-89491878 GCCTTGCTCCTGAATCCCAAGGG - Intergenic
993791786 5:92218864-92218886 GCAGGGCTCCAAAATCCTAGAGG - Intergenic
993933505 5:93972068-93972090 GCCATGCTCATAAATCCTGGTGG - Intronic
994291380 5:98032023-98032045 GCCTTGCTCCAAAATTCTTGAGG + Intergenic
994855440 5:105113636-105113658 GCCTTGCTTCAGAATCCTAGAGG + Intergenic
994984425 5:106915785-106915807 GCCTTGCTCCAAAATCCTATAGG + Intergenic
995269562 5:110205517-110205539 GGCTTGCTCCAAAATCTTAGAGG + Intergenic
995427738 5:112043778-112043800 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
995645266 5:114304600-114304622 GCCTTACTCCAGAATCCTAAGGG + Intergenic
995776292 5:115727732-115727754 CCTTGGCTCCAAAATCCTAAAGG + Intergenic
995827196 5:116313874-116313896 GCCTTGCTTCAAAACCTTAAAGG + Intronic
995926946 5:117386119-117386141 ACTTTGCTCCAAAATCAGAGTGG - Intergenic
996164960 5:120212560-120212582 GCCTTGCTCCAAAATCATAGAGG + Intergenic
996488669 5:124066652-124066674 GCTTTGCTCCAAAATCCTAAAGG + Intergenic
996825558 5:127677783-127677805 GACTTGCTCCAAAAGCATAGAGG - Intergenic
998290341 5:140908603-140908625 GCCTTGCTCCAAAATCCTTGAGG + Intronic
999351383 5:150874793-150874815 GCCTTGCTCCACAATCCTAGAGG - Intronic
1000223251 5:159234300-159234322 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
1000416968 5:160993850-160993872 GCATTGCTTCAAAATCCTAGAGG - Intergenic
1001173590 5:169444591-169444613 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1001528971 5:172449068-172449090 GCCAGGCTCCAGAAGCCTAGGGG - Intronic
1002688543 5:181034589-181034611 GCCTTCCTTCTAAATACTAGAGG - Intergenic
1002997961 6:2304695-2304717 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1003469927 6:6420126-6420148 GCCTTGCTCCAAAATCTTAAAGG + Intergenic
1003791215 6:9549940-9549962 GCCTTCCTCCAAACTCCTAGAGG - Intergenic
1004824292 6:19403287-19403309 GCCTTACTCCAAATTCCCAGAGG + Intergenic
1004945043 6:20603157-20603179 AATTTGCTCTAAAATCCTAGAGG - Intronic
1005716103 6:28549969-28549991 GACTGCCTCCAAAACCCTAGAGG + Intergenic
1006001551 6:30969024-30969046 GACTTGTTCCAAAATCCTAGAGG - Intergenic
1006062346 6:31433171-31433193 GCCTTGCTCCAAAATCCTGGAGG - Intergenic
1006720100 6:36144655-36144677 GCCTGGCTCCATGATCATAGAGG - Intergenic
1007505912 6:42335224-42335246 GCCTTGCTCCCAGATGCTGGGGG + Intronic
1008079362 6:47178437-47178459 GTCTTGCTCCAAAACCCTAAAGG + Intergenic
1008266927 6:49439340-49439362 CCCTTCCTCCAAAATCTTAGAGG + Intronic
1008400287 6:51055420-51055442 GTCTTGCTCAAAAACCCTAGAGG - Intergenic
1008820393 6:55625101-55625123 GCCTTGTTCCAAAATCCTAGAGG - Intergenic
1009390117 6:63135129-63135151 GCCTTGATCCAAATTCCTATGGG + Intergenic
1009526615 6:64754864-64754886 GTCTTGCTCCAGTATCTTAGGGG - Intronic
1009770337 6:68136903-68136925 GCCTTACTACAAAATTCTAGAGG + Intergenic
1009806490 6:68606901-68606923 GCCATGCTTCAAAATCCTAGAGG - Intergenic
1009851930 6:69209009-69209031 GCCTTGCTCCAAAATCCTAGAGG + Intronic
1010325334 6:74556650-74556672 ACCTTGCTCCACAATCCTAGAGG + Intergenic
1010580759 6:77593957-77593979 GTCTTGCTTCAAAATCCTAGAGG + Intergenic
1010818626 6:80388349-80388371 GTCTAGGTCCACAATCCTAGAGG - Intergenic
1010854106 6:80815468-80815490 TCCTTGCTCCAAAATCCTAAAGG + Intergenic
1010938248 6:81886468-81886490 GCCTTGCTCCAAAATCCAAGAGG + Intergenic
1011069096 6:83361614-83361636 GCCTTGCCCTAAAACCCTAGAGG - Intronic
1011136597 6:84106989-84107011 GCCTTGCTGTAAAATCGTAAAGG + Intergenic
1012108576 6:95197788-95197810 GCCTTGTTCCAAAATTCTACAGG + Intergenic
1012344583 6:98170268-98170290 GCTTTGCTCCAAAATCCTAGAGG - Intergenic
1012362994 6:98406735-98406757 GCTTTGCTCCAAAATCCTCAGGG + Intergenic
1012374609 6:98546670-98546692 GCCTTGCTCCAAAGGCTGAGTGG - Intergenic
1012730456 6:102874268-102874290 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1012920798 6:105219596-105219618 ACCTTGCTCAAAAATCCTAGAGG + Intergenic
1012964127 6:105655299-105655321 ACTTTGCTCCAAAATCCTAATGG - Intergenic
1013086808 6:106864137-106864159 ACCTTGCTCCACAATCAGAGTGG + Intergenic
1013406666 6:109849751-109849773 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1014363404 6:120508405-120508427 GCCTTGTTCCAAAACTTTAGAGG + Intergenic
1014534203 6:122596681-122596703 GCCTTGCTCCAAAATCCTGGAGG + Intronic
1014895648 6:126896523-126896545 ACCTTGCTACAAAATTCTAAAGG - Intergenic
1015095455 6:129409652-129409674 GCCTTGCTCCAAAATCCTAGAGG + Intronic
1015443291 6:133272616-133272638 GCCTTGCTCCAAAATCCTAGAGG + Intronic
1015466854 6:133557768-133557790 GCCTTGGTCCAAAATCCTAGAGG + Intergenic
1015475744 6:133657440-133657462 GTCTTGCTCCAAAATCCTAGAGG - Intergenic
1016119919 6:140332743-140332765 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
1016144286 6:140649351-140649373 TCCTTGCTCCAAAATCCTAGAGG - Intergenic
1016174918 6:141069146-141069168 GACTTGCTCCAAAATCTTAGAGG + Intergenic
1016419617 6:143870733-143870755 GCCTTGCTCCAAAATCCTAGAGG + Intronic
1016475666 6:144424289-144424311 GCCTTGCCCCCAAATTCTGGTGG + Intronic
1016576263 6:145572638-145572660 GCTTTGTACCAAAATCCTAGAGG + Intronic
1016594546 6:145784829-145784851 GCAGTGCTCCAAAATCCTAAAGG - Intergenic
1017044078 6:150330902-150330924 GCCTTGCTCCAAAATCCTAAAGG + Intergenic
1017227810 6:152041142-152041164 GCCTTGCTCCAAATTCCTAGAGG + Intronic
1017388460 6:153912258-153912280 GCCTTGCTTAAAACTCCTAGAGG + Intergenic
1017977123 6:159368108-159368130 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
1018122933 6:160655273-160655295 GCCTTGCTCCAAAATCCTAGAGG + Intronic
1018535037 6:164810545-164810567 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
1018599879 6:165527475-165527497 GCCTTGCTCCAAAATCCTAGAGG - Intronic
1020396713 7:7725463-7725485 GCCTTGCTCCAAAATCTTAGAGG - Intronic
1020472239 7:8551523-8551545 ACCTTGTTCCAAAATCGTAAAGG - Intronic
1020533239 7:9360954-9360976 ACTTTGCTCTAAAATCCTAGTGG - Intergenic
1020584326 7:10047109-10047131 GCTTTGCTCCAAAATTCTAAAGG - Intergenic
1020710344 7:11597574-11597596 GCCTTGTTCCAAAATCCTAGAGG - Intronic
1022078882 7:27000281-27000303 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1023606312 7:41934375-41934397 GCCTTGCTCCAGAAACTTAGGGG - Intergenic
1024491838 7:49994664-49994686 GCCTTCCTCCGAAATTCTAAAGG + Intronic
1024744200 7:52388386-52388408 GCCTTGCTTCAAAATCCTGGGGG - Intergenic
1024866095 7:53906290-53906312 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1024958256 7:54949133-54949155 GCCTTGCTCCAAAATCCTCAAGG + Intergenic
1026046494 7:66909150-66909172 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
1027685791 7:81277903-81277925 GTCTTGCTCCAAAATCCTAGAGG - Intergenic
1027735002 7:81920819-81920841 ACTTTGCTCCAAAATCAGAGGGG + Intergenic
1027799760 7:82736383-82736405 GACTTTTTCCAAAATCCTAAGGG - Intergenic
1028043855 7:86091414-86091436 GTCTTTCTCCAAAATCCTAGAGG - Intergenic
1028136689 7:87230298-87230320 ACTTTGCTCCAAAATCAGAGAGG - Intergenic
1028141730 7:87281932-87281954 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1028237817 7:88382769-88382791 GACTTGCTCCAAAATCCTAGAGG - Intergenic
1028812214 7:95100746-95100768 GCCCAGTTCCAAAAGCCTAGGGG - Intronic
1028935008 7:96455011-96455033 GCCTTGCTCCAAAATCCTAAAGG - Intergenic
1029961256 7:104690996-104691018 ACCTTGCTCCAAAATCCTAGAGG - Intronic
1030277453 7:107736062-107736084 GCCTTGCTCAAAAATCCTAGAGG - Intergenic
1030457467 7:109793104-109793126 GTATTGCTCCAAAATCCTAGAGG + Intergenic
1031236822 7:119187963-119187985 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1031676553 7:124618297-124618319 GCCTTGCTTCAAAATCCTAGAGG - Intergenic
1031761414 7:125717065-125717087 GCTTTGCTCTAAAATGCTAAAGG - Intergenic
1031832992 7:126649964-126649986 GCCTTGTTCCAAAATCCTAGAGG - Intronic
1031954983 7:127933890-127933912 TCCTTGCTCCAAAGTCTCAGAGG - Intronic
1032153109 7:129447010-129447032 GCCTTGCTCCAAAATCCTAAAGG + Intronic
1032187733 7:129741704-129741726 GCATTCCTTCAAAATCCTAATGG - Intronic
1033019372 7:137707242-137707264 TCCTTCTTCCAAAATGCTAGAGG - Intronic
1033058238 7:138079877-138079899 GACTTGCTCCAGAACCCTACAGG + Intronic
1033076253 7:138252993-138253015 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1034357259 7:150460992-150461014 GCTTTGCTCCAAAATCTTTAGGG + Intronic
1034563464 7:151896051-151896073 TCCTTGCTACAGAATCCCAGAGG + Intergenic
1035146287 7:156820954-156820976 GCGTTGCCCCAACATCCTAAGGG - Intronic
1036796478 8:11759805-11759827 CCCTCACTCCAAAATCCTACTGG + Exonic
1036915532 8:12800037-12800059 ACCTTGCTTCAAAATCAGAGTGG + Intergenic
1037019892 8:13957408-13957430 CCTTTGCTCCAAAATCCTAAGGG - Intergenic
1037364598 8:18108321-18108343 GCCCTGCTCCAAAATCCAAGAGG + Intergenic
1037612625 8:20489106-20489128 GCCTTGCTCCAAAACCCTAAGGG + Intergenic
1037677667 8:21065757-21065779 GCCCTGCTACAGAATTCTAGTGG - Intergenic
1039324176 8:36466578-36466600 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
1039576319 8:38626663-38626685 GCCTAGCTCCGAAATCCAACTGG + Intergenic
1040030989 8:42823483-42823505 GCCCTGCTCCAAAGTCTTAAAGG + Intergenic
1040711014 8:50188820-50188842 GCCTTGATCCCAAATCCTAAAGG + Intronic
1041152946 8:54955270-54955292 GCCTTGCTCCAGCATCCCAGAGG + Intergenic
1041934549 8:63321277-63321299 GCCTTGCTTCAAAATCCTAGAGG - Intergenic
1042068179 8:64901867-64901889 GCTTTGCTCAAAAATCCTGAGGG - Intergenic
1043082623 8:75784910-75784932 ACCTTGCTCCAAAATTGGAGTGG + Intergenic
1043232521 8:77820956-77820978 ACTTTGCTCCAAAATCCTGAAGG + Intergenic
1043259975 8:78184246-78184268 GCTTTGCTCCAAAATCCTAGAGG + Intergenic
1044133750 8:88558981-88559003 GTGTTGCTCCAAAATCCTAAGGG - Intergenic
1044150797 8:88773022-88773044 TCCTTGCTCCAAAATTCTAGAGG - Intergenic
1044202386 8:89452435-89452457 GCCTTGCTCCAAAATCCTATAGG - Intergenic
1044285977 8:90412499-90412521 GCTTTGCTCCAAAATCCTAGAGG + Intergenic
1044487155 8:92767173-92767195 GCCTTGCTCCAAAATCCTGGAGG + Intergenic
1044637812 8:94344027-94344049 ACCTTTCTCCCAAATCATAGTGG - Intergenic
1045180395 8:99775320-99775342 GCCTGGCTCCCAAATCCATGAGG - Intronic
1045221833 8:100207014-100207036 GCCTTGCTCCAAAATCCTAGAGG - Intronic
1046128679 8:109941655-109941677 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
1046197550 8:110884170-110884192 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1046585790 8:116147772-116147794 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
1047387944 8:124426730-124426752 CCCTCACTCCAAAATCCTACTGG + Intergenic
1047453623 8:124989260-124989282 GCCTTGCTCCAAAATCCTAAAGG - Intergenic
1048137209 8:131758054-131758076 ACCTTGCTTCAGAATCCTATAGG + Intergenic
1048435752 8:134415722-134415744 GATTTGCTCCAAAGCCCTAGAGG + Intergenic
1048910089 8:139126877-139126899 CCCTTGCTCCAAAATCCTAAAGG + Intergenic
1048916282 8:139186830-139186852 GTCTTGCTCCAGGATCTTAGAGG - Intergenic
1050482669 9:6102550-6102572 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1050888739 9:10796807-10796829 ACCTTGCTCCAAAACCCTAAAGG + Intergenic
1051044217 9:12854292-12854314 GTTTTGTTCCAAAATCCTAGGGG - Intergenic
1051882142 9:21850609-21850631 ACCTTGCTCCAAAATCCTAGAGG - Intronic
1051966458 9:22834524-22834546 ACCTTGCTCCAAAATCCTAGAGG - Intergenic
1051971180 9:22889693-22889715 TCCTTGCTCCGAAAACCTAAAGG + Intergenic
1052368646 9:27640783-27640805 GCCTTGCTCCAAAGTCCTAGAGG - Intergenic
1052442274 9:28512335-28512357 GTCTTGCTCCAAAATCCTAGAGG + Intronic
1052498486 9:29258828-29258850 GCTTTACTCCAGAATCCCAGGGG + Intergenic
1053695963 9:40639556-40639578 GCCTTGCTGCAAAATACTAGAGG + Intergenic
1053942947 9:43270594-43270616 GCCTTGCTGCAAAATACTAGAGG + Intergenic
1054307210 9:63438774-63438796 GCCTTGCTGCAAAATACTAGAGG + Intergenic
1054405942 9:64762766-64762788 TCCTTGCTGCAAAATACTAGAGG + Intergenic
1054439568 9:65248253-65248275 TCCTTGCTGCAAAATACTAGAGG + Intergenic
1054490839 9:65773686-65773708 TCCTTGCTGCAAAATACTAGAGG - Intergenic
1055429976 9:76233453-76233475 GCCATCATCAAAAATCCTAGAGG - Exonic
1055890979 9:81123000-81123022 GCTTTGCTCCAAAATCAGAGTGG + Intergenic
1055903946 9:81271257-81271279 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
1056156660 9:83845156-83845178 GCCTTGCTCCAAAATTCTAGAGG - Intronic
1056314239 9:85372998-85373020 GCCTTACTCCAAAATCCTAGAGG + Intergenic
1056353878 9:85778371-85778393 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
1058019891 9:100076027-100076049 GCCTTGCTCCAAAATCCTAGAGG - Intronic
1058239795 9:102542440-102542462 ATCTTGCTCCAAAATCCTAGAGG - Intergenic
1059196510 9:112375921-112375943 GTCTTGCTCCAAAATCCTAGAGG + Intergenic
1060178774 9:121517264-121517286 GCCTGGCTCCAAAATCCTAAGGG - Intergenic
1060805146 9:126570741-126570763 GCCTTGCTCCAAAATCCTAAAGG + Intergenic
1061036056 9:128114941-128114963 GCCTTGCCCCAAGTTCCTGGTGG - Intergenic
1202778410 9_KI270717v1_random:13169-13191 GCCTTGCTGCAAAATACTAGAGG + Intergenic
1185935911 X:4257144-4257166 ACTTTGCTCCAAAATCAGAGTGG - Intergenic
1186279490 X:7977065-7977087 GACTTGCTCCAAAATCCTAGAGG - Intergenic
1186384099 X:9091815-9091837 GCCTTGCTCCAAAATCCTAGAGG + Intronic
1186469772 X:9812162-9812184 GCCTTGCTCCAAAATCCTAGAGG + Intronic
1187522321 X:20024663-20024685 GCCTGGCCCCAAAGTCCAAGAGG + Intronic
1187541303 X:20198392-20198414 GCCTTTCTCCAAATGCCTGGGGG - Intronic
1188759935 X:34014631-34014653 GCCTTCCTTCAAAATACTAAGGG + Intergenic
1190255267 X:48757750-48757772 GCTTTGCTCCAAAATCCTAAAGG - Intergenic
1190620765 X:52284877-52284899 ACCTTGCTCCACAATCAGAGCGG + Intergenic
1190721642 X:53153663-53153685 TCTTTGCTCTAAAATCCTAAGGG + Intergenic
1190767189 X:53485236-53485258 TACTTGCTCTAAAGTCCTAGAGG + Intergenic
1190996753 X:55617522-55617544 GCCTTGCTCCAAAATCCTAGTGG + Intergenic
1191134036 X:57044541-57044563 GTCTTGCTCCAAAATCCTAGAGG + Intergenic
1191630042 X:63312642-63312664 GCCTTGCTTTAAAATCCCAGAGG + Intergenic
1191631288 X:63324825-63324847 GTCTTGCTCAAAAATCTCAGGGG - Intergenic
1191658810 X:63629860-63629882 GCCTTTCTCCAAAATCCTAGAGG + Intergenic
1191719246 X:64215763-64215785 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
1191742547 X:64451362-64451384 GCCTTGGTCCAAAATCCTAGAGG + Intergenic
1191832735 X:65432376-65432398 GACTTGCTCCAAAATTCTAAAGG + Intronic
1191932922 X:66394107-66394129 GCCTTGCTCCAAAACCTTAGAGG - Intergenic
1192297716 X:69868070-69868092 GCCTTGCTCCAAAATCCTAGAGG + Intronic
1192661566 X:73047816-73047838 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
1192789402 X:74366493-74366515 GCTTTGCTCCAAAATCCTAATGG + Intergenic
1192996187 X:76515523-76515545 GCCTTGCATCAAAATCCTAAAGG - Intergenic
1193053485 X:77125713-77125735 GCCTTGCTTCAAAATCCTACAGG - Intergenic
1193297775 X:79852619-79852641 GCCTTTCTCCAAAATCCTAGAGG - Intergenic
1193356251 X:80523070-80523092 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1193447150 X:81618716-81618738 GCCTTCCTCCAAAATCCTAGAGG - Intergenic
1193480226 X:82018577-82018599 GCATTGCTCCAAAATCCTAAAGG - Intergenic
1193573673 X:83174986-83175008 GCCTTGCTCCAAAATCTTAGAGG + Intergenic
1193832945 X:86310042-86310064 TTCTTGCTCCAAAATCTTAGAGG - Intronic
1193841412 X:86412687-86412709 GCCTTACTTCAAAATCCTAGAGG + Intronic
1193904481 X:87225776-87225798 GCCTTGCTCCTAAAGCCTAGAGG - Intergenic
1193914806 X:87351983-87352005 GCCTTGCTCCAAAATCCTACAGG + Intergenic
1193957277 X:87878155-87878177 GCTTTGCTCCAAAATCCTGGAGG - Intergenic
1194163002 X:90478594-90478616 ACTTTGCTTCAAAATCCTAAAGG + Intergenic
1194179596 X:90695990-90696012 GCCTTGCTTCAAAATCCTACAGG + Intergenic
1194210273 X:91062299-91062321 GCCTTACTCCAAAATCCTAGAGG - Intergenic
1194343306 X:92731029-92731051 ACCTTGCTCCAAAATCCTAGAGG - Intergenic
1194443544 X:93961048-93961070 GCCTTGCTCTAAAATCCTAGAGG - Intergenic
1194513422 X:94822307-94822329 GCCTTGCTCCAAAATTCTGTAGG + Intergenic
1194521077 X:94919384-94919406 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1194604394 X:95962033-95962055 GCCTTGCTCCAAAATCCTAGAGG + Intergenic
1194792430 X:98167591-98167613 CCCTTGCTTCAAAATTCTACTGG - Intergenic
1194833952 X:98658749-98658771 ACCTTGCTCCAAAATCCCAGAGG - Intergenic
1194849251 X:98852229-98852251 GCCTCGCTCCAAAATCATAGAGG + Intergenic
1194870716 X:99127812-99127834 GTCTTGCTCAAAAATTCTAAAGG - Intergenic
1195477065 X:105299393-105299415 TCCTAGCTCCAAACTCCTTGGGG - Intronic
1195782360 X:108479920-108479942 GTCTTGGTCCAAAATCCTAGAGG + Intronic
1195936468 X:110130615-110130637 GGCAGGCTCCAAAATCCTAAGGG - Intronic
1196182889 X:112714237-112714259 GCTTTGCTCCAAAATCTGTGGGG + Intergenic
1196201054 X:112886343-112886365 GCCTGGCCCCAAAATTCTACAGG - Intergenic
1197002282 X:121452866-121452888 GCCTTTCTCCAAAATTCTAGAGG - Intergenic
1197097462 X:122612783-122612805 GCCTTGCTCAAAAATCCTACAGG - Intergenic
1197245051 X:124159049-124159071 GCCTCGCTCCAAAATACTAGAGG + Intronic
1197372063 X:125637921-125637943 GCTTTGCTCCAAAATTCTAGAGG + Intergenic
1197386778 X:125812298-125812320 GCCTTGCTCCCAAATCCTAGAGG + Intergenic
1197405084 X:126039143-126039165 GCCTTGCTCCAAAATGTTAGAGG - Intergenic
1197409327 X:126096470-126096492 ACCTTGCTCTAAAATCCTAGAGG + Intergenic
1197591862 X:128419332-128419354 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1198456751 X:136824770-136824792 GCCTTGCTCCAGAACCTTAAGGG - Intergenic
1198701294 X:139400241-139400263 GCCTTGCTCCAAAGTCCTAGAGG - Intergenic
1198702788 X:139415645-139415667 GGCTTGCTCCAGAATCTCAGTGG - Intergenic
1198783045 X:140257849-140257871 GCCTTGTTCTGAAATCCTAGAGG + Intergenic
1199024375 X:142919664-142919686 ACCTTGCTCCAAAATCCTAGAGG - Intergenic
1199144447 X:144349020-144349042 GCCTTGCTCCAAAATCCTTGAGG + Intergenic
1199371619 X:147056506-147056528 ACTTTGCTCCAAAATCCTAAGGG + Intergenic
1199580344 X:149354120-149354142 GCCTTGCTCCCAAATCTCAAAGG - Intergenic
1199877502 X:151946119-151946141 GCCATTCTCCAGAACCCTAGGGG + Intergenic
1199997695 X:153036579-153036601 GCCCTGCTCCAGAACCCTAGAGG - Intergenic
1200340499 X:155390695-155390717 GCCTTGCTCCAAAATCCTAGCGG + Intergenic
1200509279 Y:4056326-4056348 ACTTTGCTTCAAAATCCTAAAGG + Intergenic
1200521266 Y:4211975-4211997 GCCTTGCTTCAAAATCCTAGAGG - Intergenic
1200526258 Y:4278159-4278181 GCCTTGCTTCAAAATCCTACAGG + Intergenic
1200651665 Y:5847694-5847716 GCCTTGCTCCAAAATCCTAGAGG - Intergenic
1200746065 Y:6904927-6904949 GTCTTGCTCCAAAATCCTAGAGG + Intergenic
1200973129 Y:9177765-9177787 GCATTGTTGCAAAATCCTAGAGG + Intergenic
1201796635 Y:17903466-17903488 GCCTTGCTTCAAAATCCTAGAGG + Intergenic
1201804920 Y:18002519-18002541 GCCTTGCTTCAAAATCCTAGAGG - Intergenic
1202137949 Y:21686748-21686770 GCATTGTTGCAAAATCCTAGAGG - Intergenic