ID: 1000223472

View in Genome Browser
Species Human (GRCh38)
Location 5:159236041-159236063
Sequence GGTGGATGTAGTTACTATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000223472_1000223477 8 Left 1000223472 5:159236041-159236063 CCATTATAGTAACTACATCCACC No data
Right 1000223477 5:159236072-159236094 CATGGTTGAGTGCCTCAACTTGG No data
1000223472_1000223473 -10 Left 1000223472 5:159236041-159236063 CCATTATAGTAACTACATCCACC No data
Right 1000223473 5:159236054-159236076 TACATCCACCTTGCCTTTCATGG No data
1000223472_1000223479 23 Left 1000223472 5:159236041-159236063 CCATTATAGTAACTACATCCACC No data
Right 1000223479 5:159236087-159236109 CAACTTGGCCCCTGCCACCTTGG No data
1000223472_1000223480 24 Left 1000223472 5:159236041-159236063 CCATTATAGTAACTACATCCACC No data
Right 1000223480 5:159236088-159236110 AACTTGGCCCCTGCCACCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000223472 Original CRISPR GGTGGATGTAGTTACTATAA TGG (reversed) Intergenic
No off target data available for this crispr