ID: 1000223473

View in Genome Browser
Species Human (GRCh38)
Location 5:159236054-159236076
Sequence TACATCCACCTTGCCTTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000223471_1000223473 0 Left 1000223471 5:159236031-159236053 CCTTTGCTGTCCATTATAGTAAC No data
Right 1000223473 5:159236054-159236076 TACATCCACCTTGCCTTTCATGG No data
1000223472_1000223473 -10 Left 1000223472 5:159236041-159236063 CCATTATAGTAACTACATCCACC No data
Right 1000223473 5:159236054-159236076 TACATCCACCTTGCCTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000223473 Original CRISPR TACATCCACCTTGCCTTTCA TGG Intergenic
No off target data available for this crispr