ID: 1000223479

View in Genome Browser
Species Human (GRCh38)
Location 5:159236087-159236109
Sequence CAACTTGGCCCCTGCCACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000223474_1000223479 5 Left 1000223474 5:159236059-159236081 CCACCTTGCCTTTCATGGTTGAG 0: 3
1: 79
2: 127
3: 168
4: 349
Right 1000223479 5:159236087-159236109 CAACTTGGCCCCTGCCACCTTGG No data
1000223476_1000223479 -3 Left 1000223476 5:159236067-159236089 CCTTTCATGGTTGAGTGCCTCAA No data
Right 1000223479 5:159236087-159236109 CAACTTGGCCCCTGCCACCTTGG No data
1000223475_1000223479 2 Left 1000223475 5:159236062-159236084 CCTTGCCTTTCATGGTTGAGTGC 0: 5
1: 76
2: 141
3: 146
4: 282
Right 1000223479 5:159236087-159236109 CAACTTGGCCCCTGCCACCTTGG No data
1000223472_1000223479 23 Left 1000223472 5:159236041-159236063 CCATTATAGTAACTACATCCACC No data
Right 1000223479 5:159236087-159236109 CAACTTGGCCCCTGCCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000223479 Original CRISPR CAACTTGGCCCCTGCCACCT TGG Intergenic
No off target data available for this crispr