ID: 1000226104

View in Genome Browser
Species Human (GRCh38)
Location 5:159263395-159263417
Sequence TTGGAGACGCTGTTGGGGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 197}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000226089_1000226104 25 Left 1000226089 5:159263347-159263369 CCACCGCGCTCCAGGTGAGGGGT 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1000226104 5:159263395-159263417 TTGGAGACGCTGTTGGGGCTCGG 0: 1
1: 0
2: 0
3: 15
4: 197
1000226097_1000226104 -7 Left 1000226097 5:159263379-159263401 CCCTGGCGCGCTGCCCTTGGAGA 0: 1
1: 0
2: 1
3: 6
4: 89
Right 1000226104 5:159263395-159263417 TTGGAGACGCTGTTGGGGCTCGG 0: 1
1: 0
2: 0
3: 15
4: 197
1000226098_1000226104 -8 Left 1000226098 5:159263380-159263402 CCTGGCGCGCTGCCCTTGGAGAC 0: 1
1: 0
2: 1
3: 1
4: 99
Right 1000226104 5:159263395-159263417 TTGGAGACGCTGTTGGGGCTCGG 0: 1
1: 0
2: 0
3: 15
4: 197
1000226094_1000226104 15 Left 1000226094 5:159263357-159263379 CCAGGTGAGGGGTTGCGGGGCAC 0: 1
1: 0
2: 0
3: 23
4: 178
Right 1000226104 5:159263395-159263417 TTGGAGACGCTGTTGGGGCTCGG 0: 1
1: 0
2: 0
3: 15
4: 197
1000226090_1000226104 22 Left 1000226090 5:159263350-159263372 CCGCGCTCCAGGTGAGGGGTTGC 0: 1
1: 0
2: 1
3: 21
4: 105
Right 1000226104 5:159263395-159263417 TTGGAGACGCTGTTGGGGCTCGG 0: 1
1: 0
2: 0
3: 15
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000226104 Original CRISPR TTGGAGACGCTGTTGGGGCT CGG Intronic
900198136 1:1387784-1387806 TAGGAGACGCTGATCGGGATGGG + Exonic
901295427 1:8157402-8157424 TTGGAGACGCAGTTGGTACATGG + Intergenic
901883819 1:12209105-12209127 TTGGAGACTCTGTGGGGCCTTGG + Exonic
902381664 1:16055664-16055686 CTGGAGACACTGCTGGGGGTGGG - Exonic
906078792 1:43070135-43070157 ATGGAGAGAATGTTGGGGCTGGG - Intergenic
907401177 1:54225884-54225906 TTGGAGCAGCTGTGGGGGGTGGG - Intronic
907505463 1:54914954-54914976 TTGGAGTCCCTGTTGGGCCTTGG + Intergenic
907602408 1:55784480-55784502 TTGGAGTCCTTGTTGGGCCTCGG + Intergenic
910591171 1:88929150-88929172 TTGGAGTCCTTGTTGGGCCTCGG - Intergenic
912463791 1:109855372-109855394 TTGGAGTCCTTGTTGGGCCTCGG + Intergenic
912713037 1:111963087-111963109 TTGGAGACCCAGCTGGGGATGGG - Intronic
913095551 1:115512602-115512624 TTGTAGAAGGTGTTGGGGTTTGG + Intergenic
915312890 1:155013330-155013352 CTGGAGACAGTGCTGGGGCTTGG - Intronic
915586612 1:156847257-156847279 TTTGAGAAGCTGTTGAAGCTAGG - Intronic
916577854 1:166082945-166082967 TGGGAGAGGATGTAGGGGCTGGG + Intronic
919839146 1:201596735-201596757 CTGGAAACTCTGTTGGGGCAGGG - Intergenic
924743921 1:246815115-246815137 TTGGAGAGGTAGGTGGGGCTGGG + Intergenic
924805645 1:247359383-247359405 TAGGAGACCCTGGTGGGGGTAGG + Intergenic
1063592342 10:7407244-7407266 CTGGGGAGGCTGTTGGGGGTGGG - Intronic
1063740014 10:8807258-8807280 TTGGAGAAGTTGATGGTGCTTGG - Intergenic
1067904702 10:50278584-50278606 TAAGAGAAGCTGTGGGGGCTGGG + Intergenic
1069909776 10:71751971-71751993 TTGGAGATGCTGCTGAGGCTTGG - Intronic
1071507749 10:86242930-86242952 TTGGTGAGGCAGGTGGGGCTGGG - Intronic
1072377964 10:94837285-94837307 TTGGAGTCCTTGTTGGGCCTTGG + Intronic
1072471792 10:95720138-95720160 TTGGAGTCCTTGTTGGGCCTCGG + Intronic
1073181816 10:101588102-101588124 TTGGAGAGACTCTTGGGGCCGGG - Exonic
1073623846 10:105075810-105075832 TTGAAGAGGTTGCTGGGGCTGGG - Intronic
1074705413 10:116125440-116125462 TTGGACACGCTGGTGGTGCACGG + Exonic
1075555268 10:123426441-123426463 TTAGACACCCTGCTGGGGCTGGG - Intergenic
1076219618 10:128722735-128722757 TTGGAAAGGCTGTTTGGCCTGGG - Intergenic
1076800893 10:132827701-132827723 TTGGGGAAGCTCCTGGGGCTGGG - Intronic
1077253521 11:1571115-1571137 GGGGTGACCCTGTTGGGGCTGGG + Intronic
1079601181 11:22314850-22314872 TTGGAGTCCTTGTTGGGCCTCGG + Intergenic
1080762519 11:35265707-35265729 TGGGTGACTCTTTTGGGGCTGGG - Exonic
1081999777 11:47387925-47387947 TGGGAGACCCTGCAGGGGCTGGG + Intergenic
1082988484 11:59187392-59187414 TTGGAGCCACTGTTGGGGGGAGG + Intronic
1085282530 11:75340543-75340565 GAGGAGAGGCTGTGGGGGCTGGG + Intronic
1085439150 11:76542228-76542250 CTGGGAAGGCTGTTGGGGCTGGG - Exonic
1085635826 11:78158899-78158921 TTGGAGAAGCAGGTGGGGCCAGG - Intergenic
1086142274 11:83512322-83512344 TTCGAGACGCAGTTCTGGCTTGG + Intronic
1086441862 11:86836298-86836320 TTGGAGTCCTTGTTGGGCCTTGG + Intronic
1087190983 11:95254185-95254207 TTCTAGAGGCTGTTGGGGGTTGG + Intergenic
1090398793 11:126435481-126435503 TTAGAGACTCTGGAGGGGCTAGG + Intronic
1090401579 11:126452750-126452772 CCGGAGCCGCTGTCGGGGCTGGG + Intronic
1091374370 12:16207-16229 TTGGAGACTGTGTGGGGCCTGGG + Intergenic
1091924736 12:4336306-4336328 GAGGACACGCTGGTGGGGCTGGG - Intronic
1092183504 12:6462193-6462215 TTGGAGTAGCTGTGGGGGCTTGG - Exonic
1092469317 12:8764167-8764189 TTGGAGTCCTTGTTGGGCCTCGG + Intronic
1095125436 12:38471695-38471717 TTGGAGTCCTTGTTGGGCCTCGG - Intergenic
1097377127 12:58855027-58855049 TTGGAGTCCTTGTTGGGCCTCGG + Intergenic
1101746531 12:107545847-107545869 CTGGACAGGCTGTTGGGGCTAGG - Intronic
1101761338 12:107661279-107661301 TTGGAGACTGTGTAGGGGCTAGG - Intergenic
1103081479 12:118027375-118027397 TTGGAAATGCATTTGGGGCTGGG + Intronic
1103447546 12:121004057-121004079 TTGGAGAGGGAGGTGGGGCTTGG + Exonic
1103643402 12:122371318-122371340 TTGTATAGGCTCTTGGGGCTTGG - Intronic
1103803231 12:123553150-123553172 TTGGAGTCCTTGTTGGGCCTCGG - Intergenic
1106074019 13:26441849-26441871 TGGGAGATGTTCTTGGGGCTTGG + Intergenic
1108876809 13:55058328-55058350 TTGGAGTCCTTGTTGGGCCTTGG - Intergenic
1110453180 13:75660148-75660170 TTCTAGACGATGTAGGGGCTAGG + Intronic
1113083915 13:106547746-106547768 TTGGAGACGGGGTTGGGAATTGG + Intronic
1113659650 13:112096939-112096961 TAGGAGAAGATGTTGGGGTTGGG - Intergenic
1114384440 14:22240971-22240993 TTGGAGTCCTTGTTGGGCCTTGG - Intergenic
1114668879 14:24398613-24398635 TGGGAGAGGCTGTTGGGGGTAGG + Intergenic
1114671038 14:24411226-24411248 TTGGTGACACTGTGGAGGCTGGG - Intronic
1115774674 14:36702321-36702343 TTGGAAACAATGTTTGGGCTTGG - Intronic
1117357781 14:54942543-54942565 TTGGAGTCGGAGTTGGGGCTTGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119560071 14:75582885-75582907 TTGTAGAAGGTGTTGGGGTTTGG + Intronic
1119685604 14:76628580-76628602 TAGGAGAGGCTGGTGGGGCCTGG - Intergenic
1120377787 14:83731178-83731200 TTGGAGACACTGATAAGGCTTGG - Intergenic
1121991623 14:98563345-98563367 TTGGGGACACTGTGGGAGCTGGG - Intergenic
1123028154 14:105438338-105438360 TTGGGGAAGCTGTGGGGGCCAGG - Intronic
1123479031 15:20614106-20614128 ATGGAGAAGCTGATGGGGCAGGG + Intergenic
1123638981 15:22386279-22386301 ATGGAGAAGCTGATGGGGCAGGG - Intergenic
1127074163 15:55309889-55309911 TTGGAGTCCTTGTTGGGCCTCGG + Intronic
1128222389 15:65978557-65978579 CTGGAGACACTGCTGAGGCTCGG - Intronic
1128362490 15:66972236-66972258 TTGGAGTCCTTGTTGGGCCTCGG + Intergenic
1128605936 15:69036877-69036899 TTGGGTAAGATGTTGGGGCTGGG - Intronic
1130301029 15:82680098-82680120 CTGGAGGCGTTGTCGGGGCTGGG - Intronic
1132761106 16:1509050-1509072 GTGGAGCCACTGATGGGGCTGGG + Intronic
1133035372 16:3031142-3031164 CTGGAGCCGCTGTGGGGGCCAGG + Exonic
1138572547 16:57884911-57884933 AGGGAGAGGCTGCTGGGGCTGGG + Intronic
1141721279 16:85756791-85756813 TGGGAGACGCTTTTTGTGCTAGG - Intergenic
1141863288 16:86732776-86732798 ATGCAGGCGCTGTTGGTGCTGGG + Intergenic
1142612143 17:1114791-1114813 TTAGAGATGCTGGTGGGGCTGGG + Intronic
1146269739 17:31477016-31477038 GTGGAGAAGGTGGTGGGGCTGGG - Intronic
1146532440 17:33620877-33620899 CTGGAGAGGCTGTGGGGGCTGGG - Intronic
1147258713 17:39196769-39196791 TTGGAGGCGTTTTTGGGGCGGGG + Intronic
1147487073 17:40826486-40826508 TTGGAGTCACTTTAGGGGCTGGG + Intronic
1148669865 17:49402522-49402544 TTGGACACCCTTTTGGGGGTGGG - Intronic
1151967329 17:77438125-77438147 TTGGAGAAGCCGTTGGGCCGAGG + Intronic
1152244139 17:79176462-79176484 AAGGAGACCCAGTTGGGGCTGGG - Intronic
1157189913 18:45572421-45572443 TTGGAAAAGATGTTGGGACTAGG - Intronic
1157692074 18:49691891-49691913 TAGGAGATGGTCTTGGGGCTGGG - Intergenic
1161524770 19:4747111-4747133 GTGGAGACGCTGTGGGGGAAAGG - Intergenic
1161990477 19:7681513-7681535 TTTGAGACGCGGATGGGCCTGGG - Intronic
1162109144 19:8390728-8390750 TGGGAGAGGCTGTTAGGGCGGGG + Intronic
1163353503 19:16794604-16794626 TTGGAGAAGGGGGTGGGGCTTGG + Intronic
1164057476 19:21633807-21633829 TTGGAGTTGTTGTTGGGCCTCGG - Intergenic
1164173685 19:22749332-22749354 TTGGAGTCCTTGTTGGGCCTCGG - Intergenic
1165278230 19:34773037-34773059 TTGCAGACGCTTGTGGGGGTGGG + Exonic
1165447255 19:35863089-35863111 TTGGGGACCCTCTTGGGACTGGG - Intronic
1166089306 19:40497885-40497907 TTGGGGAGGGTGTTGGGGATGGG - Intronic
1166765200 19:45248758-45248780 GTGGGGACGCTGTTGGGGAAGGG + Intronic
1167649369 19:50721091-50721113 CTGGAGGTGCTGTTGGAGCTGGG - Intergenic
1168146471 19:54422193-54422215 TTGGAGACGGTGGAGAGGCTGGG + Exonic
924974006 2:156691-156713 TTGGAGTCCTTGTTGGGCCTTGG + Intergenic
926864597 2:17343514-17343536 TTGGAGTCCTTGTTGGGCCTCGG - Intergenic
927427240 2:22995216-22995238 TTGGAAACGCTGGTGGTGGTGGG - Intergenic
928677175 2:33661409-33661431 TTGGAGTCCTTGTTGGGCCTCGG - Intergenic
929558966 2:42943723-42943745 CTGGAGAAGTTGATGGGGCTTGG + Intergenic
931796112 2:65711720-65711742 TTGGAGAAGCTGATTGGGTTGGG + Intergenic
933175123 2:79165886-79165908 TTGGAGTCCTTGTTGGGCCTTGG + Intergenic
933251668 2:80036084-80036106 TGGGTGACGCTGGTGGGGGTAGG - Intronic
935712914 2:105914952-105914974 TAGTAGACACTGCTGGGGCTGGG - Intergenic
935748817 2:106212608-106212630 TTGGAGTCCTTGTTGGGCCTTGG - Intergenic
937040482 2:118816774-118816796 TTGTAGACACTGTTGTGCCTGGG + Intergenic
939021061 2:136958980-136959002 ATGGAGGTGCTGGTGGGGCTAGG + Intronic
939493517 2:142903184-142903206 TTGGAGTCCTTGTTGGGCCTCGG + Intronic
941832550 2:169978287-169978309 TTGGAGGGGCTGTGGGGCCTGGG + Intronic
941914992 2:170805931-170805953 TTGGAAACGCTGTGGGGTTTGGG + Intergenic
942831018 2:180237525-180237547 TTGGAGTCCTTGTTGGGCCTTGG - Intergenic
943355402 2:186849217-186849239 TTGGTGACGGTGGTTGGGCTCGG + Intergenic
944957913 2:204833897-204833919 TTGGAGAGGTAGGTGGGGCTGGG - Intronic
946090258 2:217216153-217216175 ACGGAGAGGCTCTTGGGGCTGGG - Intergenic
946161383 2:217838065-217838087 TGGGAGACGCTCTTGGGGTTTGG + Intronic
947564611 2:231185917-231185939 TTGGAAGTGCTGGTGGGGCTGGG - Intergenic
949002979 2:241628037-241628059 CTGGAGAGGCTGGTGGAGCTGGG - Intronic
1174068862 20:47886061-47886083 TTGGAGATCCTGGAGGGGCTTGG + Intergenic
1175958667 20:62624118-62624140 TTGCAGATGCTGGTGGGGCGTGG - Intergenic
1176195688 20:63835579-63835601 CTGGAGCGGCAGTTGGGGCTTGG - Intergenic
1176216432 20:63950200-63950222 TTGGAGAAGGTAGTGGGGCTGGG - Intronic
1177263380 21:18755914-18755936 TTGGAGTCCTTGTTGGGCCTTGG + Intergenic
1178108764 21:29349977-29349999 TTGGAGAGGCTGGTGGGGAGGGG - Intronic
1178280244 21:31276133-31276155 TTGAAGACGGTGTTGGGGGGTGG + Intronic
1179259000 21:39742001-39742023 TTGGAGTCTTTGTTGGGCCTCGG + Intergenic
1179910136 21:44443085-44443107 TTGGTGACGCTGATGGGGTGAGG - Intergenic
1182573587 22:31257809-31257831 TTGGTAACGCTGTTGGTGATGGG + Intronic
950525322 3:13519608-13519630 TTGGAGAGACTGCTGGGGCTGGG + Intergenic
951200551 3:19872151-19872173 TTGGAGTCCTTGTTGGGCCTTGG + Intergenic
951285706 3:20810564-20810586 TCTGAGAGGCTGTTGGGGTTGGG - Intergenic
954141487 3:48609134-48609156 TTGGGGACGCTTTTGGGGAGAGG - Intronic
956091650 3:65674009-65674031 TTGGAGACTCTCTTGGGCCCAGG + Intronic
958016113 3:87941959-87941981 TTGGAGTCCTTGTTGGGCCTCGG + Intergenic
962160175 3:132990614-132990636 AAGGAGAAGCTGATGGGGCTTGG - Intergenic
962495583 3:135936158-135936180 TTGGAGTCCTTGTTGGGCCTTGG - Intergenic
963188091 3:142440539-142440561 TTGGAGTCCTTGTTGGGCCTCGG - Intronic
963969727 3:151416331-151416353 CTGGGGAGGCTGCTGGGGCTGGG - Exonic
966353640 3:179057095-179057117 TTGGAGTCCTTGTTGGGCCTCGG - Intronic
969260510 4:6030493-6030515 GTGGAGACGCTGTGTGGGATGGG - Intronic
969645095 4:8423476-8423498 TTGGAGTCCTTGTTGGGCCTCGG - Intronic
972781220 4:42288512-42288534 TTGGAGTCCTTGTTGGGCCTCGG + Intergenic
975313676 4:72929269-72929291 TTGGAGCCCTTGTTGGGCCTTGG + Intergenic
976022502 4:80646134-80646156 CTGGAGGCACTGTTGTGGCTTGG - Intronic
976189984 4:82478278-82478300 TTGGAGTCCTTGTTGGGCCTCGG - Intergenic
977177137 4:93831241-93831263 TTGCAGATGTTGTTGGGGCAAGG - Intergenic
981495620 4:145388990-145389012 TTTGAGTCGCCTTTGGGGCTGGG - Intergenic
982839082 4:160159787-160159809 TGTGACACCCTGTTGGGGCTCGG - Intergenic
983394430 4:167175643-167175665 GTGGAGATGCTGTGGAGGCTTGG + Intronic
983666895 4:170192940-170192962 TTGGAGTCCTTGTTGGGCCTCGG + Intergenic
983732042 4:171007883-171007905 CTGGAGACCATGTTGGAGCTTGG + Intergenic
984098856 4:175463660-175463682 TTGTAGAAGCGGTTGGGGTTTGG + Intergenic
985284609 4:188322704-188322726 TTGGGGACTCGGTTGGAGCTCGG + Intergenic
985552100 5:538954-538976 TGGGAGACGCATGTGGGGCTGGG - Intergenic
985795767 5:1961333-1961355 TGGGAGAAGCTCTTGGTGCTTGG + Intergenic
989688704 5:44116776-44116798 TTGTAGAAGGAGTTGGGGCTTGG + Intergenic
990212542 5:53495683-53495705 TTGTAAAGGCTGTTGAGGCTAGG + Intergenic
995819039 5:116206358-116206380 TTGGAGACGGTGGTCGGGCACGG + Intronic
1000226104 5:159263395-159263417 TTGGAGACGCTGTTGGGGCTCGG + Intronic
1001191157 5:169632560-169632582 ATGGAGACATTGATGGGGCTGGG + Intergenic
1002052109 5:176577077-176577099 TTGGTGTTGCTGTGGGGGCTGGG + Intronic
1004281466 6:14282888-14282910 TGGGCGAAGCTGTTGGAGCTGGG + Intergenic
1005380506 6:25229478-25229500 TTGGAGACACTGGTGGGAGTGGG + Intergenic
1005705545 6:28448309-28448331 TTGGACAAGCTGTTAGGGCTTGG - Intergenic
1006670095 6:35724984-35725006 TTCCAAACGCTGTTGGGGGTTGG + Intronic
1006986705 6:38180288-38180310 GTGGCCACGCTGCTGGGGCTGGG + Intronic
1007380642 6:41488271-41488293 TTGGAGAGGCTGCAGGGGCAGGG - Intergenic
1007622203 6:43222132-43222154 TTGCAGAGGCTGTTGAGGCTTGG - Intronic
1011076915 6:83447652-83447674 TTGGAGTCCTTGTTGGGCCTTGG - Intergenic
1011539720 6:88416894-88416916 TTGGAGTCCTTGTTGGGCCTCGG + Intergenic
1013437364 6:110124176-110124198 AGAGAGACGCTGATGGGGCTGGG - Intronic
1013983244 6:116158904-116158926 TTTGAGACGCAGATGGGGATTGG + Intronic
1015865347 6:137721671-137721693 TTGGAGTCATTGTTGGGGCTCGG + Intergenic
1015966106 6:138696583-138696605 TAGGAGACCCTGTTGGGGAAGGG - Intergenic
1016161342 6:140884140-140884162 TTGGAGAAACTATTGGTGCTAGG - Intergenic
1020689775 7:11339755-11339777 TTGGGGATGCTGGTGGGGCAGGG + Intergenic
1021151324 7:17154163-17154185 TTGGAGAGTTTGTTGGGGATTGG - Intergenic
1028588443 7:92473369-92473391 TTGGAGTCCTTGTTGGGCCTTGG + Intronic
1032863780 7:135905729-135905751 TTGGAGATGCAGATGGGGATTGG + Intergenic
1036213869 8:6863470-6863492 TTGGGGAGGCTGGTGGGGATTGG + Intergenic
1036459457 8:8938992-8939014 TTGGAGATGGTGTTGGGTGTGGG + Intergenic
1037829173 8:22177959-22177981 TGGGAGACGGGATTGGGGCTGGG + Intronic
1038433110 8:27515644-27515666 CTGCAGACGCTGTGGGGCCTGGG + Intronic
1040452551 8:47562601-47562623 TTGCTGACGCTGTTGCTGCTGGG + Intronic
1041427892 8:57743368-57743390 TGGGAGACGCTGTTGGCCATTGG + Intergenic
1041651645 8:60308713-60308735 TTGTAGAAGGTGTTGGGGTTTGG + Intergenic
1043490105 8:80740435-80740457 TTGGAGTCCTTGTTGGGCCTTGG - Intronic
1043807116 8:84685400-84685422 GTGGAGACGATGGTGGGGGTTGG - Intronic
1048114311 8:131504785-131504807 TTGGGGACCATGTTGGTGCTTGG - Intergenic
1053569365 9:39288248-39288270 TCGGAGACGCAGCTGGGGCCGGG - Intronic
1053835324 9:42129290-42129312 TCGGAGACGCAGCTGGGGCCGGG - Exonic
1054090994 9:60847232-60847254 TCGGAGACGCAGCTGGGGCCGGG - Intergenic
1054112405 9:61122788-61122810 TCGGAGACGCAGCTGGGGCCGGG - Intergenic
1054127780 9:61330762-61330784 TCGGAGACGCAGCTGGGGCCGGG + Intergenic
1054595300 9:67059341-67059363 TCGGAGACGCAGCTGGGGCCGGG + Intergenic
1060116155 9:120942632-120942654 TTTGAGACGCTGTGGAGGGTGGG - Intergenic
1185504707 X:623893-623915 CTGGAGACGCAGGCGGGGCTGGG - Intergenic
1185600757 X:1337351-1337373 GGGGAGCCGCTTTTGGGGCTGGG + Intronic
1191805586 X:65131704-65131726 TTGTAGAAGGTGTTGGGGTTTGG + Intergenic
1192939839 X:75901008-75901030 TTGGAGTCCTTGTTGGGCCTCGG + Intergenic
1195535089 X:106001375-106001397 TTGGAGTCCTTGTTGGGCCTCGG - Intergenic
1196527212 X:116740628-116740650 TTGGAGTCCTTGTTGGGCCTCGG + Intergenic
1197871185 X:131064154-131064176 TAGGAGACTGGGTTGGGGCTGGG + Intronic