ID: 1000228237

View in Genome Browser
Species Human (GRCh38)
Location 5:159290597-159290619
Sequence CAAGCTGGACACTTAATCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000228237_1000228247 15 Left 1000228237 5:159290597-159290619 CCCAGGATTAAGTGTCCAGCTTG No data
Right 1000228247 5:159290635-159290657 TGCCAGCAGGGGCACAGCAGAGG No data
1000228237_1000228244 3 Left 1000228237 5:159290597-159290619 CCCAGGATTAAGTGTCCAGCTTG No data
Right 1000228244 5:159290623-159290645 ATGCATGGCCTATGCCAGCAGGG No data
1000228237_1000228243 2 Left 1000228237 5:159290597-159290619 CCCAGGATTAAGTGTCCAGCTTG No data
Right 1000228243 5:159290622-159290644 CATGCATGGCCTATGCCAGCAGG No data
1000228237_1000228249 29 Left 1000228237 5:159290597-159290619 CCCAGGATTAAGTGTCCAGCTTG No data
Right 1000228249 5:159290649-159290671 CAGCAGAGGTCTGCACACATAGG No data
1000228237_1000228245 4 Left 1000228237 5:159290597-159290619 CCCAGGATTAAGTGTCCAGCTTG No data
Right 1000228245 5:159290624-159290646 TGCATGGCCTATGCCAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000228237 Original CRISPR CAAGCTGGACACTTAATCCT GGG (reversed) Intergenic
No off target data available for this crispr